RB1, RB transcriptional corepressor 1, 5925

N. diseases: 339; N. variants: 239
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs387906521
rs387906521 		1.000 0.080 13 48303715 upstream gene variant G/A snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 6 1989 2014
dbSNP: rs387906521
rs387906521 		1.000 0.080 13 48303715 upstream gene variant G/A snv
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs387906520
rs387906520 		1.000 0.080 13 48303724 upstream gene variant G/T snv
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs1555279195
rs1555279195 		13 48303914 frameshift variant -/CAAAACCCCCCGAAAAACGGCCGCCACCGCCGCC delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1131690852
rs1131690852 		1.000 0.080 13 48303925 frameshift variant -/C delins
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 1.000 3 2003 2015
dbSNP: rs1131690852
rs1131690852 		1.000 0.080 13 48303925 frameshift variant -/C delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1131690845
rs1131690845 		13 48303931 frameshift variant CGA/GG delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1566174065
rs1566174065 		1.000 0.080 13 48303947 frameshift variant C/- delins
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs1064792974
rs1064792974 		1.000 0.080 13 48303948 frameshift variant GCCGCCGCTGCCGCCGCGGAACCCCCGGC/- delins
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs1566174074
rs1566174074 		1.000 0.080 13 48303952 frameshift variant -/TGCCGCCGCGGAACCCCCGGCACCGC delins
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs587776790
rs587776790 		1.000 0.080 13 48303953 frameshift variant -/GCTGCCGCCGCGGAACCCCCGGC delins
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs1555279210
rs1555279210 		1.000 0.080 13 48303957 frameshift variant -/GGAACCCCCGGCACCGCCGCCGC delins
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 1.000 1 2011 2011
dbSNP: rs1555279210
rs1555279210 		1.000 0.080 13 48303957 frameshift variant -/GGAACCCCCGGCACCGCCGCCGC delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1555279212
rs1555279212 		1.000 0.080 13 48303958 frameshift variant -/GGAACCCCCGGCACCGCCGC delins
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs587778823
rs587778823 		1.000 0.080 13 48303979 inframe insertion GCC/-;GCCGCC delins
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs1276653645
rs1276653645 		1.000 0.080 13 48303991 frameshift variant C/- delins
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs1566174147
rs1566174147 		1.000 0.080 13 48304003 frameshift variant -/A delins
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs587778869
rs587778869 		1.000 0.080 13 48304015 stop gained C/G;T snv
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs1131690913
rs1131690913 		13 48304017 frameshift variant G/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs886037649
rs886037649 		1.000 0.080 13 48304025 frameshift variant GCC/CT delins
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs1131690855
rs1131690855 		13 48304050 splice donor variant G/T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs587778862
rs587778862 		1.000 0.080 13 48307353 frameshift variant AG/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2003 2003
dbSNP: rs587778862
rs587778862 		1.000 0.080 13 48307353 frameshift variant AG/- delins
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs587778840
rs587778840 		1.000 0.080 13 48307359 frameshift variant A/- del
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0
dbSNP: rs587778824
rs587778824 		1.000 0.080 13 48307368 frameshift variant -/TA delins
CUI: C0035335
Disease: Retinoblastoma
Retinoblastoma 		Neoplasms; Eye Diseases 0.700 0