Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1482303814
rs1482303814 		1.000 5 37125344 stop gained C/T snv 7.0E-06
CUI: C4021085
Disease: Abnormality of brain morphology
Abnormality of brain morphology 		0.700 0
dbSNP: rs75589774
rs75589774 		1.000 0.080 5 37182800 missense variant G/A snv 0.11 0.10
CUI: C1865384
Disease: Amyotrophy, monomelic
Amyotrophy, monomelic 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.010 1.000 1 2012 2012
dbSNP: rs300053
rs300053 		5 37075443 regulatory region variant T/G snv 0.58
CUI: C0005890
Disease: Body Height
Body Height 		0.700 1.000 1 2019 2019
dbSNP: rs1561231553
rs1561231553 		1.000 0.080 5 37063789 splice acceptor variant G/C snv
CUI: C4551851
Disease: Cornelia de Lange Syndrome 1
Cornelia de Lange Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs398124474
rs398124474 		1.000 0.080 5 37064854 stop gained C/T snv
CUI: C4551851
Disease: Cornelia de Lange Syndrome 1
Cornelia de Lange Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587784052
rs587784052 		1.000 0.080 5 37064642 frameshift variant CACAAATTGCAAGAGTAGT/- del
CUI: C4551851
Disease: Cornelia de Lange Syndrome 1
Cornelia de Lange Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587784053
rs587784053 		1.000 0.080 5 37064650 missense variant G/C snv
CUI: C4551851
Disease: Cornelia de Lange Syndrome 1
Cornelia de Lange Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587784055
rs587784055 		1.000 0.080 5 37064752 frameshift variant GGTGCCT/- delins
CUI: C4551851
Disease: Cornelia de Lange Syndrome 1
Cornelia de Lange Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587784056
rs587784056 		1.000 0.080 5 37064776 frameshift variant AA/- delins
CUI: C4551851
Disease: Cornelia de Lange Syndrome 1
Cornelia de Lange Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs727503771
rs727503771 		1.000 0.080 5 37063829 frameshift variant GAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA/- delins
CUI: C4551851
Disease: Cornelia de Lange Syndrome 1
Cornelia de Lange Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs797045785
rs797045785 		1.000 0.080 5 37063837 frameshift variant -/G delins
CUI: C4551851
Disease: Cornelia de Lange Syndrome 1
Cornelia de Lange Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs797045786
rs797045786 		1.000 0.080 5 37063841 frameshift variant -/A delins
CUI: C4551851
Disease: Cornelia de Lange Syndrome 1
Cornelia de Lange Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs797045787
rs797045787 		1.000 0.080 5 37064751 frameshift variant -/CT delins
CUI: C4551851
Disease: Cornelia de Lange Syndrome 1
Cornelia de Lange Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs797045788
rs797045788 		1.000 0.080 5 37064773 protein altering variant ATTAA/TT delins
CUI: C4551851
Disease: Cornelia de Lange Syndrome 1
Cornelia de Lange Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs797045789
rs797045789 		1.000 0.080 5 37064819 frameshift variant CTAATAA/ATT delins
CUI: C4551851
Disease: Cornelia de Lange Syndrome 1
Cornelia de Lange Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1554117456
rs1554117456 		1.000 5 37245569 stop gained C/A snv
CUI: C0432072
Disease: Dysmorphic features
Dysmorphic features 		0.700 1.000 6 2011 2015
dbSNP: rs565629362
rs565629362 		1.000 0.160 5 37179445 splice acceptor variant T/C snv
CUI: C0431399
Disease: Familial aplasia of the vermis
Familial aplasia of the vermis 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases 0.700 0
dbSNP: rs730882217
rs730882217 		0.925 5 37153962 frameshift variant TC/- del
CUI: C0557874
Disease: Global developmental delay
Global developmental delay 		0.700 0
dbSNP: rs749523755
rs749523755 		0.882 0.080 5 37157810 stop gained A/T snv 2.4E-05 7.0E-06
CUI: C0557874
Disease: Global developmental delay
Global developmental delay 		0.700 0
dbSNP: rs775263897
rs775263897 		0.882 0.080 5 37148217 frameshift variant T/-;TT delins 4.0E-06; 8.0E-06
CUI: C0557874
Disease: Global developmental delay
Global developmental delay 		0.700 0
dbSNP: rs777686211
rs777686211 		0.851 0.200 5 37226776 frameshift variant A/-;AA delins 1.8E-04
CUI: C0557874
Disease: Global developmental delay
Global developmental delay 		0.700 0
dbSNP: rs749523755
rs749523755 		0.882 0.080 5 37157810 stop gained A/T snv 2.4E-05 7.0E-06
CUI: C0022346
Disease: Icterus
Icterus 		Pathological Conditions, Signs and Symptoms 0.700 0
dbSNP: rs775263897
rs775263897 		0.882 0.080 5 37148217 frameshift variant T/-;TT delins 4.0E-06; 8.0E-06
CUI: C0022346
Disease: Icterus
Icterus 		Pathological Conditions, Signs and Symptoms 0.700 0
dbSNP: rs777686211
rs777686211 		0.851 0.200 5 37226776 frameshift variant A/-;AA delins 1.8E-04
CUI: C0022346
Disease: Icterus
Icterus 		Pathological Conditions, Signs and Symptoms 0.700 0
dbSNP: rs777686211
rs777686211 		0.851 0.200 5 37226776 frameshift variant A/-;AA delins 1.8E-04
CUI: C4551568
Disease: Joubert syndrome 1
Joubert syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases 0.700 0