Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
1.000 | 21 | 33554945 | frameshift variant | GAAA/- | delins |
|
Nervous System Diseases | 0.700 | 1.000 | 28 | 1988 | 2016 | |||||||||
|
1.000 | 21 | 33554945 | frameshift variant | GAAA/- | delins |
|
0.700 | 1.000 | 28 | 1988 | 2016 | ||||||||||
|
1.000 | 21 | 33554945 | frameshift variant | GAAA/- | delins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases | 0.700 | 1.000 | 28 | 1988 | 2016 | |||||||||
|
1.000 | 21 | 33554005 | frameshift variant | ACTC/- | del |
|
0.700 | 1.000 | 28 | 1988 | 2016 | ||||||||||
|
1.000 | 21 | 33554005 | frameshift variant | ACTC/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 1.000 | 28 | 1988 | 2016 | |||||||||
|
1.000 | 21 | 33554005 | frameshift variant | ACTC/- | del |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases | 0.700 | 1.000 | 28 | 1988 | 2016 | |||||||||
|
1.000 | 21 | 33554005 | frameshift variant | ACTC/- | del |
|
Nervous System Diseases | 0.700 | 1.000 | 28 | 1988 | 2016 | |||||||||
|
1.000 | 21 | 33554269 | stop gained | G/T | snv |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases | 0.700 | 1.000 | 28 | 1988 | 2016 | |||||||||
|
1.000 | 21 | 33554269 | stop gained | G/T | snv |
|
0.700 | 1.000 | 28 | 1988 | 2016 | ||||||||||
|
1.000 | 21 | 33554726 | stop gained | CTG/- | del |
|
0.700 | 1.000 | 28 | 1988 | 2016 | ||||||||||
|
1.000 | 21 | 33554726 | stop gained | CTG/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 1.000 | 28 | 1988 | 2016 | |||||||||
|
21 | 33554777 | frameshift variant | GA/- | delins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases | 0.700 | 1.000 | 28 | 1988 | 2016 | ||||||||||
|
21 | 33556049 | intron variant | C/T | snv | 0.48 |
|
0.700 | 1.000 | 1 | 2019 | 2019 | ||||||||||
|
21 | 33552565 | stop gained | C/T | snv |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms | 0.700 | 0 | |||||||||||||
|
21 | 33552787 | stop gained | C/G;T | snv | 7.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms | 0.700 | 0 | ||||||||||||
|
21 | 33551596 | frameshift variant | A/- | del |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms | 0.700 | 0 | |||||||||||||
|
21 | 33549495 | frameshift variant | A/- | delins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms | 0.700 | 0 | |||||||||||||
|
21 | 33551112 | frameshift variant | AG/- | del |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms | 0.700 | 0 | |||||||||||||
|
21 | 33552827 | frameshift variant | -/GC | delins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms | 0.700 | 0 | |||||||||||||
|
21 | 33553283 | frameshift variant | C/- | delins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms | 0.700 | 0 | |||||||||||||
|
21 | 33553778 | frameshift variant | -/G | delins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms | 0.700 | 0 | |||||||||||||
|
21 | 33554229 | inframe deletion | GATTTACCATCTAAT/- | delins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms | 0.700 | 0 | |||||||||||||
|
21 | 33555318 | frameshift variant | C/- | del |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms | 0.700 | 0 | |||||||||||||
|
21 | 33553375 | inframe deletion | TGGAGCCTTCGGTTGTGACTGTCC/- | delins | 4.2E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms | 0.700 | 0 | ||||||||||||
|
21 | 33549608 | frameshift variant | A/- | delins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms | 0.700 | 0 |