Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs121909191
rs121909191 		1.000 0.080 7 19116759 missense variant G/A;C snv 4.0E-06
CUI: C4551902
Disease: Craniosynostosis, Type 1
Craniosynostosis, Type 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.800 1.000 1 2007 2007
dbSNP: rs1554441993
rs1554441993 		0.925 0.080 7 19116913 frameshift variant -/G delins
CUI: C0175699
Disease: Saethre-Chotzen Syndrome
Saethre-Chotzen Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 1.000 1 2013 2013
dbSNP: rs1554441993
rs1554441993 		0.925 0.080 7 19116913 frameshift variant -/G delins
CUI: C4551902
Disease: Craniosynostosis, Type 1
Craniosynostosis, Type 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 1.000 1 2013 2013
dbSNP: rs1554442016
rs1554442016 		0.882 0.080 7 19116972 missense variant T/A;C snv
CUI: C1876203
Disease: Frontonasal dysplasia
Frontonasal dysplasia 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.010 1.000 1 2017 2017
dbSNP: rs104894055
rs104894055 		0.925 0.080 7 19117240 stop gained G/A snv
CUI: C1863370
Disease: Saethre-Chotzen Syndrome with Eyelid Anomalies
Saethre-Chotzen Syndrome with Eyelid Anomalies 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs104894058
rs104894058 		1.000 0.080 7 19116781 stop gained C/A;G;T snv 4.0E-06
CUI: C0175699
Disease: Saethre-Chotzen Syndrome
Saethre-Chotzen Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs104894065
rs104894065 		1.000 0.080 7 19117111 stop gained G/A snv
CUI: C1867146
Disease: Robinow Sorauf syndrome
Robinow Sorauf syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs1085307555
rs1085307555 		0.925 0.080 7 19116993 missense variant C/G;T snv
CUI: C0175699
Disease: Saethre-Chotzen Syndrome
Saethre-Chotzen Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs1085307555
rs1085307555 		0.925 0.080 7 19116993 missense variant C/G;T snv
CUI: C4551902
Disease: Craniosynostosis, Type 1
Craniosynostosis, Type 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs121909186
rs121909186 		1.000 0.080 7 19117013 stop gained -/T delins
CUI: C0175699
Disease: Saethre-Chotzen Syndrome
Saethre-Chotzen Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs121909187
rs121909187 		1.000 0.080 7 19116954 stop gained G/T snv
CUI: C0175699
Disease: Saethre-Chotzen Syndrome
Saethre-Chotzen Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs1554441989
rs1554441989 		1.000 0.080 7 19116904 inframe insertion -/GGGCAGCGTGGGGATGATCTT delins
CUI: C0175699
Disease: Saethre-Chotzen Syndrome
Saethre-Chotzen Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs1554442015
rs1554442015 		0.851 0.120 7 19116970 missense variant G/C snv
CUI: C0010278
Disease: Craniosynostosis
Craniosynostosis 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs1554442015
rs1554442015 		0.851 0.120 7 19116970 missense variant G/C snv
CUI: C0175699
Disease: Saethre-Chotzen Syndrome
Saethre-Chotzen Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs1563159980
rs1563159980 		0.925 0.080 7 19116903 stop gained -/AGGGCAGCGTGGGGATGATCT delins
CUI: C0175699
Disease: Saethre-Chotzen Syndrome
Saethre-Chotzen Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs1563159980
rs1563159980 		0.925 0.080 7 19116903 stop gained -/AGGGCAGCGTGGGGATGATCT delins
CUI: C4551902
Disease: Craniosynostosis, Type 1
Craniosynostosis, Type 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs1563160116
rs1563160116 		0.925 0.080 7 19117021 stop gained G/A snv
CUI: C0175699
Disease: Saethre-Chotzen Syndrome
Saethre-Chotzen Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs1563160116
rs1563160116 		0.925 0.080 7 19117021 stop gained G/A snv
CUI: C4551902
Disease: Craniosynostosis, Type 1
Craniosynostosis, Type 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs1563160337
rs1563160337 		0.925 0.080 7 19117211 frameshift variant CGTCCCCCGCGCTTGCCGCTCG/- delins
CUI: C4551902
Disease: Craniosynostosis, Type 1
Craniosynostosis, Type 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs1563160337
rs1563160337 		0.925 0.080 7 19117211 frameshift variant CGTCCCCCGCGCTTGCCGCTCG/- delins
CUI: C0175699
Disease: Saethre-Chotzen Syndrome
Saethre-Chotzen Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0
dbSNP: rs1554442016
rs1554442016 		0.882 0.080 7 19116972 missense variant T/A;C snv
CUI: C0000768
Disease: Congenital Abnormality
Congenital Abnormality 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.010 1.000 1 2017 2017
dbSNP: rs1554442016
rs1554442016 		0.882 0.080 7 19116972 missense variant T/A;C snv
CUI: C4540299
Disease: SWEENEY-COX SYNDROME
SWEENEY-COX SYNDROME 		0.800 1.000 1 2017 2017
dbSNP: rs1554442016
rs1554442016 		0.882 0.080 7 19116972 missense variant T/A;C snv
CUI: C0432106
Disease: Midline facial cleft - Tessier cleft 0
Midline facial cleft - Tessier cleft 0 		0.010 1.000 1 2017 2017
dbSNP: rs2717329
rs2717329 		7 19023152 intron variant G/A snv 0.47
CUI: C0042834
Disease: Vital capacity
Vital capacity 		0.700 1.000 1 2019 2019
dbSNP: rs430
rs430 		7 19066916 intron variant G/A snv 5.3E-02
CUI: C0162701
Disease: Polysomnography
Polysomnography 		0.700 1.000 1 2012 2012