UBE3A, ubiquitin protein ligase E3A, 7337

N. diseases: 155; N. variants: 125
Disease: Angelman Syndrome ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs587781232
rs587781232 		1.000 0.080 15 25339131 stop lost TTTGTTTTAC/- del
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs76794400
rs76794400 		1.000 0.080 15 25339138 stop lost T/A;C snv 3.0E-03
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs1555379684
rs1555379684 		1.000 0.080 15 25339142 frameshift variant GCATGCCAAATCCTTTGGCATACGTGATGGCCTTCAACAATCTCTCTTTAAGTTTTTCTTTGCTTGAG/- del
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs797046088
rs797046088 		1.000 0.080 15 25339148 frameshift variant -/A delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1555379745
rs1555379745 		1.000 0.080 15 25339174 stop gained -/TCAACAATCTCTCTTTAAGTTTTTCTTTGCTTGAGTATTCCGGAAGTAAAAGCACATTA delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs587784527
rs587784527 		1.000 0.080 15 25339186 frameshift variant CTTT/-;CTTTCTTT delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 1999 1999
dbSNP: rs1057519062
rs1057519062 		1.000 0.080 15 25339187 frameshift variant TAAGTTTTTCTTTGCTT/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587781231
rs587781231 		1.000 0.080 15 25339188 frameshift variant TT/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 3 2001 2014
dbSNP: rs587781240
rs587781240 		1.000 0.080 15 25339188 protein altering variant -/TAAGTTTTTCTTTGCTTGAGT delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs1555379800
rs1555379800 		1.000 0.080 15 25339188 frameshift variant -/AAGTT delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587781230
rs587781230 		1.000 0.080 15 25339189 frameshift variant -/TAAGTTTTTCTTTGCTTGAGTATTCCGGAAGTAAAAGCACATTA delins 4.0E-06
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs398124440
rs398124440 		1.000 0.080 15 25339190 stop gained AAGT/-;AAGTAAGT delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs587783097
rs587783097 		1.000 0.080 15 25339193 missense variant G/A snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs797046087
rs797046087 		1.000 0.080 15 25339193 frameshift variant -/T delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587781229
rs587781229 		1.000 0.080 15 25339195 frameshift variant -/CTTT delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs1064792950
rs1064792950 		1.000 0.080 15 25339205 frameshift variant TTGAGTATTCCGGAAGT/- del
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587781228
rs587781228 		1.000 0.080 15 25339207 stop gained G/C snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 5 1999 2016
dbSNP: rs587784526
rs587784526 		1.000 0.080 15 25339211 missense variant A/G snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587781239
rs587781239 		1.000 0.080 15 25339216 missense variant G/A snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.800 1.000 6 1998 2017
dbSNP: rs587781227
rs587781227 		1.000 0.080 15 25339218 frameshift variant A/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs863224940
rs863224940 		1.000 0.080 15 25339218 frameshift variant GTAA/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587781226
rs587781226 		1.000 0.080 15 25339222 stop gained A/T snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs587781238
rs587781238 		1.000 0.080 15 25340115 start lost ATC/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs587781225
rs587781225 		1.000 0.080 15 25340150 frameshift variant CTGT/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs587781224
rs587781224 		1.000 0.080 15 25340178 frameshift variant AA/- del
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2014 2014