Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs121917768
rs121917768
1.000 0.240 16 20349071 missense variant C/G;T snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.800 1.000 14 2002 2015
dbSNP: rs121917769
rs121917769
0.925 0.240 16 20348925 missense variant A/G snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.800 1.000 14 2002 2015
dbSNP: rs121917770
rs121917770
1.000 0.240 16 20348918 missense variant T/C snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.800 1.000 14 2002 2015
dbSNP: rs121917771
rs121917771
1.000 0.240 16 20348537 missense variant C/T snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.800 1.000 14 2002 2015
dbSNP: rs121917772
rs121917772
0.882 0.240 16 20348298 missense variant A/C snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.800 1.000 14 2002 2015
dbSNP: rs1447458978
rs1447458978
1.000 0.240 16 20348594 missense variant G/A snv 4.8E-06
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.700 1.000 14 2002 2015
dbSNP: rs1555487318
rs1555487318
0.925 0.240 16 20348249 missense variant T/G snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.800 1.000 14 2002 2015
dbSNP: rs28934582
rs28934582
1.000 0.240 16 20348858 missense variant C/T snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.800 1.000 14 2002 2015
dbSNP: rs28934583
rs28934583
0.925 0.240 16 20348652 missense variant A/C;G snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.800 1.000 14 2002 2015
dbSNP: rs886043751
rs886043751
0.925 0.240 16 20348557 stop gained G/C;T snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.710 1.000 1 2007 2007
dbSNP: rs1060499657
rs1060499657
1.000 0.240 16 20348714 missense variant T/C snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.700 0
dbSNP: rs121917774
rs121917774
1.000 0.240 16 20348484 missense variant C/A snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.700 0
dbSNP: rs1555486021
rs1555486021
1.000 0.240 16 20341205 missense variant C/T snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.700 0
dbSNP: rs1555487316
rs1555487316
0.882 0.240 16 20348247 missense variant A/C snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.700 0
dbSNP: rs1555487621
rs1555487621
0.925 0.240 16 20348943 missense variant A/C snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.700 0
dbSNP: rs398122388
rs398122388
1.000 0.240 16 20348558 missense variant C/G snv
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.700 0
dbSNP: rs780462125
rs780462125
1.000 0.240 16 20348975 missense variant A/T snv 1.1E-05 2.1E-05
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.700 0
dbSNP: rs1555487528
rs1555487528
1.000 0.240 16 20348746 inframe deletion GCGCCAGTACTCGTCCAGGGTGCGGTG/- del
Hyperuricemic Nephropathy, Familial Juvenile 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.700 0