Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
0.925 | 0.120 | 3 | 134650909 | frameshift variant | -/ATGTCGATAGATACAGCACATGTCGATA | ins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases | 0.700 | 1.000 | 1 | 2017 | 2017 | ||||||||
|
0.925 | 0.120 | 3 | 134650909 | frameshift variant | -/ATGTCGATAGATACAGCACATGTCGATA | ins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases | 0.700 | 1.000 | 1 | 2017 | 2017 | ||||||||
|
0.925 | 0.120 | 3 | 134650909 | frameshift variant | -/ATGTCGATAGATACAGCACATGTCGATA | ins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases | 0.700 | 1.000 | 1 | 2017 | 2017 | ||||||||
|
3 | 134514250 | intron variant | A/G | snv | 0.63 |
|
0.700 | 1.000 | 1 | 2008 | 2008 | ||||||||||
|
3 | 134514250 | intron variant | A/G | snv | 0.63 |
|
0.700 | 1.000 | 1 | 2008 | 2008 | ||||||||||
|
1.000 | 3 | 134507193 | stop gained | G/A;T | snv | 4.0E-06 | 1.4E-05 |
|
0.700 | 0 | |||||||||||
|
1.000 | 3 | 134537160 | frameshift variant | C/- | delins | 1.6E-05 |
|
0.700 | 1.000 | 15 | 2004 | 2015 | |||||||||
|
1.000 | 0.120 | 3 | 134545716 | missense variant | G/A;T | snv | 6.0E-05; 3.2E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders | 0.010 | 1.000 | 1 | 2015 | 2015 | |||||||
|
1.000 | 3 | 134625131 | stop gained | G/A;T | snv | 1.4E-05 |
|
0.700 | 0 | ||||||||||||
|
3 | 134484505 | intron variant | C/T | snv | 0.68 |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 1 | 2017 | 2017 | |||||||||
|
3 | 134484505 | intron variant | C/T | snv | 0.68 |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 1 | 2017 | 2017 | |||||||||
|
3 | 134484505 | intron variant | C/T | snv | 0.68 |
|
0.700 | 1.000 | 1 | 2017 | 2017 | ||||||||||
|
3 | 134640105 | intron variant | C/T | snv | 0.33 |
|
0.700 | 1.000 | 1 | 2019 | 2019 | ||||||||||
|
1.000 | 3 | 134507245 | stop gained | -/TTAA | delins | 8.0E-06 |
|
0.700 | 1.000 | 1 | 2011 | 2011 | |||||||||
|
1.000 | 3 | 134549061 | splice acceptor variant | G/A;T | snv | 2.4E-05; 8.0E-06 |
|
0.700 | 0 | ||||||||||||
|
1.000 | 3 | 134495351 | stop gained | C/T | snv | 2.8E-05 | 7.0E-05 |
|
0.700 | 1.000 | 15 | 2004 | 2015 | ||||||||
|
3 | 134710087 | intron variant | C/T | snv | 2.9E-04 |
|
0.700 | 1.000 | 1 | 2017 | 2017 | ||||||||||
|
1.000 | 0.120 | 3 | 134545716 | missense variant | GC/TT | mnv |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders | 0.010 | 1.000 | 1 | 2015 | 2015 | ||||||||
|
1.000 | 3 | 134608668 | frameshift variant | C/- | del |
|
0.700 | 0 | |||||||||||||
|
3 | 134596249 | upstream gene variant | C/A | snv | 0.64 |
|
0.700 | 1.000 | 1 | 2019 | 2019 |