Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1554121443
rs1554121443
0.742 0.280 6 33438873 stop gained C/T snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs1060503383
rs1060503383
0.882 0.200 6 33441318 stop gained C/T snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs869312674
rs869312674
0.925 0.200 6 33446569 splice region variant G/A;C snv 4.0E-06
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 1.000 2 2014 2017
dbSNP: rs1060503386
rs1060503386
0.925 0.200 6 33440913 stop gained C/T snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs869312677
rs869312677
0.925 0.160 6 33446780 frameshift variant TTGGCAG/- del
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs875989808
rs875989808
0.925 0.160 6 33444529 missense variant C/T snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs397514670
rs397514670
1.000 0.160 6 33440737 missense variant C/T snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.800 1.000 6 2009 2016
dbSNP: rs1554121189
rs1554121189
1.000 0.160 6 33437760 frameshift variant -/TGGATGAC delins
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 1.000 2 2013 2013
dbSNP: rs397514741
rs397514741
1.000 0.160 6 33432724 stop gained C/T snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 1.000 2 2013 2016
dbSNP: rs869312955
rs869312955
1.000 0.160 6 33446710 stop gained C/T snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 1.000 2 2015 2016
dbSNP: rs1131691979
rs1131691979
1.000 0.160 6 33432198 frameshift variant A/- del
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 1.000 1 2014 2014
dbSNP: rs397515320
rs397515320
1.000 0.160 6 33442990 frameshift variant T/- del
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 1.000 1 2009 2009
dbSNP: rs797045012
rs797045012
1.000 0.160 6 33432683 splice acceptor variant A/C;G snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 1.000 1 2013 2013
dbSNP: rs1057518352
rs1057518352
1.000 0.160 6 33432787 stop gained C/T snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs1057519400
rs1057519400
1.000 0.160 6 33440958 frameshift variant TT/- delins
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs1057519405
rs1057519405
1.000 0.160 6 33440735 frameshift variant C/- delins
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs1057519546
rs1057519546
1.000 0.160 6 33432806 missense variant G/A snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs1060503378
rs1060503378
1.000 0.160 6 33438072 frameshift variant AG/- del
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs1060503384
rs1060503384
1.000 0.160 6 33441612 missense variant G/A snv 4.0E-06
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs1064792984
rs1064792984
1.000 0.160 6 33441360 splice donor variant CAGCTCAGCAAGGTCAGCAGATCCCC/- delins
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs1064795331
rs1064795331
1.000 0.160 6 33440769 missense variant C/T snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs1135401805
rs1135401805
1.000 0.160 6 33443742 stop gained C/T snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs121918315
rs121918315
1.000 0.160 6 33432709 stop gained A/T snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs121918316
rs121918316
1.000 0.160 6 33440787 stop gained C/G;T snv
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs1480178032
rs1480178032
1.000 0.160 6 33438874 missense variant G/A;C snv 4.0E-06
Mental Retardation, Autosomal Dominant 5
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0