Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
2 | 50288880 | intron variant | T/A;C | snv |
|
0.800 | 1.000 | 1 | 2010 | 2010 | |||||||||||
|
1.000 | 2 | 51026369 | splice donor variant | A/G | snv | 7.0E-06 |
|
0.700 | 1.000 | 3 | 2009 | 2014 | |||||||||
|
1.000 | 2 | 51026470 | splice acceptor variant | C/T | snv | 9.2E-06 | 3.5E-05 |
|
0.700 | 1.000 | 3 | 2009 | 2014 | ||||||||
|
1.000 | 0.040 | 2 | 50925810 | splice acceptor variant | CACAATCCAGAAACCAACAAATGTTCAGAAAGAAGTTCAACTTACCATCTAACTTCAAGATGTACCCTATTAGTACTAAGAAATAAAGGACAAATGAGAGTTGGAAAAATAAGGTAGAAAGCACCCACCTTCCACATTGTTGTCTTCTGAAAGCACATGACAAGGAGGGAGAGAAAAGGAAAAACATTCATTAAGCAGCATGCAGACTGGACCTTGCCTTTGCATGTCTTCCTCATGCAAGGCACCAAACACATCATGCAAGTGCTCCATCACTATCATTCAAGGGGGAAAACAAAATCACAGGGAAGCAGGTTCCCTCCCATTGGCAGCATTGATAGGAAGTGAGACAAACTTTCATAATACTGCCATGCCCTGTGCAAAGAGTTTTTAAAAAAATCTTTCAACTACCCAGTATAAAGCAAACATTATTGTTATTACATGTTGCTGGTG/- | del |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 2 | 2012 | 2013 | ||||||||
|
2 | 49973972 | missense variant | A/G | snv | 0.85 | 0.82 |
|
0.700 | 1.000 | 2 | 2019 | 2019 | |||||||||
|
2 | 50521617 | intron variant | G/A;C | snv |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 1 | 2015 | 2015 | ||||||||||
|
2 | 50521617 | intron variant | G/A;C | snv |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 1 | 2015 | 2015 | ||||||||||
|
2 | 50968463 | intron variant | T/A;C | snv |
|
0.700 | 1.000 | 1 | 2017 | 2017 | |||||||||||
|
1.000 | 0.080 | 2 | 50961428 | intron variant | T/A;C | snv |
|
Nervous System Diseases; Mental Disorders | 0.700 | 1.000 | 1 | 2009 | 2009 | ||||||||
|
1.000 | 0.040 | 2 | 50855616 | intron variant | G/A | snv | 0.16 |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 1 | 2019 | 2019 | |||||||
|
1.000 | 0.040 | 2 | 50855616 | intron variant | G/A | snv | 0.16 |
|
Mental Disorders | 0.700 | 1.000 | 1 | 2019 | 2019 | |||||||
|
2 | 50699981 | intron variant | T/C | snv | 1.5E-03 |
|
0.700 | 1.000 | 1 | 2015 | 2015 | ||||||||||
|
1.000 | 0.080 | 2 | 49957256 | intron variant | C/T | snv | 0.12 |
|
Chemically-Induced Disorders; Mental Disorders | 0.700 | 1.000 | 1 | 2013 | 2013 | |||||||
|
1.000 | 0.080 | 2 | 49957256 | intron variant | C/T | snv | 0.12 |
|
Chemically-Induced Disorders; Mental Disorders | 0.700 | 1.000 | 1 | 2013 | 2013 | |||||||
|
1.000 | 0.080 | 2 | 49957256 | intron variant | C/T | snv | 0.12 |
|
Chemically-Induced Disorders | 0.700 | 1.000 | 1 | 2013 | 2013 | |||||||
|
1.000 | 0.080 | 2 | 49957256 | intron variant | C/T | snv | 0.12 |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 1 | 2013 | 2013 | |||||||
|
2 | 50871905 | intron variant | C/T | snv | 0.51 |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 1 | 2018 | 2018 | |||||||||
|
1.000 | 0.080 | 2 | 50709898 | intron variant | A/G | snv | 0.54 |
|
Nutritional and Metabolic Diseases; Nervous System Diseases | 0.700 | 1.000 | 1 | 2007 | 2007 | |||||||
|
1.000 | 0.080 | 2 | 50971652 | intron variant | G/A | snv | 1.6E-02 |
|
0.700 | 1.000 | 1 | 2018 | 2018 | ||||||||
|
1.000 | 0.080 | 2 | 50971652 | intron variant | G/A | snv | 1.6E-02 |
|
Nutritional and Metabolic Diseases; Endocrine System Diseases | 0.700 | 1.000 | 1 | 2018 | 2018 | |||||||
|
2 | 50629732 | intron variant | A/G | snv | 0.55 |
|
0.700 | 1.000 | 1 | 2019 | 2019 | ||||||||||
|
2 | 50400459 | intron variant | A/G | snv | 0.26 |
|
0.700 | 1.000 | 1 | 2019 | 2019 | ||||||||||
|
0.925 | 0.040 | 2 | 50978611 | intron variant | C/T | snv | 2.0E-02 |
|
0.700 | 1.000 | 1 | 2018 | 2018 | ||||||||
|
0.925 | 0.040 | 2 | 50978611 | intron variant | C/T | snv | 2.0E-02 |
|
Musculoskeletal Diseases | 0.700 | 1.000 | 1 | 2018 | 2018 | |||||||
|
2 | 50202723 | intron variant | T/C | snv | 0.28 |
|
0.700 | 1.000 | 1 | 2018 | 2018 |