CD36, CD36 molecule, 948

N. diseases: 351; N. variants: 61
Disease: Platelet Glycoprotein IV Deficiency ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs75326924
rs75326924 		0.882 0.120 7 80656687 missense variant C/T snv 1.1E-03 1.0E-04
CUI: C1842090
Disease: Platelet Glycoprotein IV Deficiency
Platelet Glycoprotein IV Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 5 1993 2002
dbSNP: rs121918035
rs121918035 		1.000 0.080 7 80673392 missense variant A/C;G snv 2.6E-04; 4.0E-06; 9.6E-05 7.0E-06
CUI: C1842090
Disease: Platelet Glycoprotein IV Deficiency
Platelet Glycoprotein IV Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 2 1995 2002
dbSNP: rs142186404
rs142186404 		1.000 0.080 7 80669964 missense variant T/C;G snv 6.0E-05; 3.2E-05
CUI: C1842090
Disease: Platelet Glycoprotein IV Deficiency
Platelet Glycoprotein IV Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 2 1995 2002
dbSNP: rs572295823
rs572295823 		1.000 0.080 7 80661110 frameshift variant CA/- delins 1.2E-03 2.8E-04
CUI: C1842090
Disease: Platelet Glycoprotein IV Deficiency
Platelet Glycoprotein IV Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 1.000 6 1994 2015
dbSNP: rs550565800
rs550565800 		1.000 0.080 7 80673382 inframe insertion ATTGTGCCTATT/-;ATTGTGCCTATTGTGCCTATT delins 3.2E-04
CUI: C1842090
Disease: Platelet Glycoprotein IV Deficiency
Platelet Glycoprotein IV Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 1.000 5 2001 2016
dbSNP: rs148910227
rs148910227 		1.000 0.080 7 80672800 missense variant C/G;T snv 4.0E-06; 5.5E-04
CUI: C1842090
Disease: Platelet Glycoprotein IV Deficiency
Platelet Glycoprotein IV Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 1.000 3 2006 2015
dbSNP: rs70961716
rs70961716 		1.000 0.080 7 80671102 frameshift variant AAAA/-;AAAAA delins
CUI: C1842090
Disease: Platelet Glycoprotein IV Deficiency
Platelet Glycoprotein IV Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 1.000 2 1996 2002
dbSNP: rs3211893
rs3211893 		0.925 0.080 7 80661212 splice donor variant T/A;C;G snv 4.0E-06; 5.5E-04; 4.0E-06; 1.0E-04
CUI: C1842090
Disease: Platelet Glycoprotein IV Deficiency
Platelet Glycoprotein IV Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs3211938
rs3211938 		0.882 0.200 7 80671133 stop gained T/G snv 6.2E-03 2.6E-02
CUI: C1842090
Disease: Platelet Glycoprotein IV Deficiency
Platelet Glycoprotein IV Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.020 1.000 2 2008 2012
dbSNP: rs146885545
rs146885545 		1.000 0.080 7 80666447 missense variant C/G;T snv 4.0E-06; 4.0E-06
CUI: C1842090
Disease: Platelet Glycoprotein IV Deficiency
Platelet Glycoprotein IV Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.010 < 0.001 1 2007 2007
dbSNP: rs3765187
rs3765187 		0.925 0.160 7 80656687 missense variant C/T snv
CUI: C1842090
Disease: Platelet Glycoprotein IV Deficiency
Platelet Glycoprotein IV Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.010 1.000 1 2013 2013
dbSNP: rs376632451
rs376632451 		1.000 0.080 7 80674123 synonymous variant A/C snv 4.8E-05 2.8E-05
CUI: C1842090
Disease: Platelet Glycoprotein IV Deficiency
Platelet Glycoprotein IV Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.010 < 0.001 1 2014 2014