| Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
A | 0.800 | CausalMutation | CLINVAR | |||||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | ||||||||||
|
|
|
T | 0.800 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.800 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.800 | CausalMutation | CLINVAR | |||||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | ||||||||||
|
|
|
A | 0.800 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
0.700 | GeneticVariation | UNIPROT | ||||||||||
|
|
|
0.700 | GeneticVariation | UNIPROT | ||||||||||
|
|
|
0.700 | GeneticVariation | UNIPROT | ||||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
0.700 | GeneticVariation | UNIPROT | ||||||||||
|
|
|
0.700 | GeneticVariation | UNIPROT | A Comprehensive Genomic Analysis Reveals the Genetic Landscape of Mitochondrial Respiratory Chain Complex Deficiencies. | 26741492 | 2016 | |||||||
|
|
|
0.700 | GeneticVariation | UNIPROT | A Comprehensive Genomic Analysis Reveals the Genetic Landscape of Mitochondrial Respiratory Chain Complex Deficiencies. | 26741492 | 2016 | |||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | A novel homozygous SCO2 mutation, p.G193S, causing fatal infantile cardioencephalomyopathy. | 19353847 | 2009 | |||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | A novel homozygous SCO2 mutation, p.G193S, causing fatal infantile cardioencephalomyopathy. | 19353847 | 2009 | |||||||
|
|
|
0.700 | GeneticVariation | UNIPROT | A novel homozygous SCO2 mutation, p.G193S, causing fatal infantile cardioencephalomyopathy. | 19353847 | 2009 | |||||||
|
|
|
CTGAGTCACTGCTGCATGCT | 0.700 | GeneticVariation | CLINVAR | A novel mutation in the SCO2 gene in a neonate with early-onset cardioencephalomyopathy. | 20159436 | 2010 | ||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | Cooperation between COA6 and SCO2 in COX2 maturation during cytochrome c oxidase assembly links two mitochondrial cardiomyopathies. | 25959673 | 2015 | |||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | Cooperation between COA6 and SCO2 in COX2 maturation during cytochrome c oxidase assembly links two mitochondrial cardiomyopathies. | 25959673 | 2015 |