Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
T | 0.800 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.800 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.800 | SusceptibilityMutation | CLINVAR | |||||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | ||||||||||
|
|
|
C | 0.800 | SusceptibilityMutation | CLINVAR | |||||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | ||||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
AGTTGCCATCTCTGTTGAGATCTTAG | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | ALX4 dysfunction disrupts craniofacial and epidermal development. | 19692347 | 2009 | ||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | ALX4 dysfunction disrupts craniofacial and epidermal development. | 19692347 | 2009 | ||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | ALX4 gain-of-function mutations in nonsyndromic craniosynostosis. | 22829454 | 2012 | ||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | ALX4 gain-of-function mutations in nonsyndromic craniosynostosis. | 22829454 | 2012 | ||||||
|
|
|
0.700 | GeneticVariation | GWASCAT | Association of Novel ALX4 Gene Polymorphisms with Antidepressant Treatment Response: Findings from the CO-MED Trial. | 29998114 | 2018 |