Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
0.700 | GeneticVariation | GWASDB | Genome-wide meta-analyses of nonsyndromic cleft lip with or without cleft palate identify six new risk loci. | 22863734 | 2012 | |||||||
|
|
|
AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG | 0.700 | CausalMutation | CLINVAR | Mutations in ZIC2 in human holoprosencephaly: description of a novel ZIC2 specific phenotype and comprehensive analysis of 157 individuals. | 19955556 | 2010 | ||||||
|
|
|
G | 0.700 | GeneticVariation | CLINVAR | Mutations in ZIC2 in human holoprosencephaly: description of a novel ZIC2 specific phenotype and comprehensive analysis of 157 individuals. | 19955556 | 2010 | ||||||
|
|
|
G | 0.700 | GeneticVariation | CLINVAR | The full spectrum of holoprosencephaly-associated mutations within the ZIC2 gene in humans predicts loss-of-function as the predominant disease mechanism. | 19177455 | 2009 | ||||||
|
|
|
AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG | 0.700 | CausalMutation | CLINVAR | In vitro analysis of partial loss-of-function ZIC2 mutations in holoprosencephaly: alanine tract expansion modulates DNA binding and transactivation. | 15590697 | 2005 | ||||||
|
|
|
AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG | 0.700 | CausalMutation | CLINVAR | Holoprosencephaly due to mutations in ZIC2: alanine tract expansion mutations may be caused by parental somatic recombination. | 11285244 | 2001 | ||||||
|
|
|
AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG | 0.700 | CausalMutation | CLINVAR | Holoprosencephaly due to mutations in ZIC2, a homologue of Drosophila odd-paired. | 9771712 | 1998 | ||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
0.700 | GeneticVariation | UNIPROT | ||||||||||
|
|
|
C | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
GC | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
GC | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
0.700 | CausalMutation | CLINVAR |