ALMS1, ALMS1 centrosome and basal body associated protein, 7840
N. diseases: 147; N. variants: 195
Source: ALL
Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
T | 0.700 | CausalMutation | CLINVAR | Mutation of ALMS1, a large gene with a tandem repeat encoding 47 amino acids, causes Alström syndrome. | 11941370 | 2002 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | Spectrum of ALMS1 variants and evaluation of genotype-phenotype correlations in Alström syndrome. | 17594715 | 2007 | ||||||
|
|
|
G | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
GA | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | GeneticVariation | CLINVAR | Mutations in ALMS1 cause obesity, type 2 diabetes and neurosensory degeneration in Alström syndrome. | 11941369 | 2002 | ||||||
|
|
|
T | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
C | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
G | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | Spectrum of ALMS1 variants and evaluation of genotype-phenotype correlations in Alström syndrome. | 17594715 | 2007 | ||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | Molecular approach in the study of Alström syndrome: analysis of ten Spanish families. | 22876109 | 2012 | ||||||
|
|
|
CTTGGAATGTCTTTCCAAGA | 0.700 | GeneticVariation | CLINVAR | Mutations in ALMS1 cause obesity, type 2 diabetes and neurosensory degeneration in Alström syndrome. | 11941369 | 2002 | ||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | Spectrum of ALMS1 variants and evaluation of genotype-phenotype correlations in Alström syndrome. | 17594715 | 2007 | ||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | Pediatric cardiomyopathy: importance of genetic and metabolic evaluation. | 22555271 | 2012 | ||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | Arrayed primer extension technology simplifies mutation detection in Bardet-Biedl and Alström syndrome. | 21157496 | 2011 | ||||||
|
|
|
AT | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | Spectrum of ALMS1 variants and evaluation of genotype-phenotype correlations in Alström syndrome. | 17594715 | 2007 | ||||||
|
|
|
T | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | Alström Syndrome: Mutation Spectrum of ALMS1. | 25846608 | 2015 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | Molecular genetics of cone-rod dystrophy in Chinese patients: New data from 61 probands and mutation overview of 163 probands. | 26992781 | 2016 | ||||||
|
|
|
C | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
A | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
C | 0.700 | GeneticVariation | CLINVAR |