Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
C | 0.700 | GeneticVariation | CLINVAR | ||||||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
C | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
G | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
A | 0.700 | GeneticVariation | CLINVAR | The Fanconi anemia DNA damage repair pathway in the spotlight for germline predisposition to colorectal cancer. | 27165003 | 2016 |
|||||||
|
|
G | 0.700 | GeneticVariation | CLINVAR | ||||||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | The DNA helicase BRIP1 is defective in Fanconi anemia complementation group J. | 16116423 | 2005 |
|||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | The BRCA1-interacting helicase BRIP1 is deficient in Fanconi anemia. | 16116424 | 2005 |
|||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | Clinical characteristics and genetic subtypes of Fanconi anemia in Saudi patients. | 26968956 | 2016 |
|||||||
|
|
T | 0.800 | CausalMutation | CLINVAR | ||||||||||
|
|
G | 0.800 | GeneticVariation | CLINVAR | ||||||||||
|
|
C | 0.700 | GeneticVariation | CLINVAR | ||||||||||
|
|
C | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
G | 0.700 | GeneticVariation | CLINVAR | ||||||||||
|
|
C | 0.700 | GeneticVariation | CLINVAR | ||||||||||
|
|
GGTTGTTGAAATATCAATTTGATATA | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
AAG | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
C | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.700 | GeneticVariation | CLINVAR | Mutations in BRIP1 confer high risk of ovarian cancer. | 21964575 | 2011 |
|||||||
|
|
T | 0.700 | GeneticVariation | CLINVAR | The DNA helicase BRIP1 is defective in Fanconi anemia complementation group J. | 16116423 | 2005 |
|||||||
|
|
T | 0.700 | GeneticVariation | CLINVAR | Truncating mutations in the Fanconi anemia J gene BRIP1 are low-penetrance breast cancer susceptibility alleles. | 17033622 | 2006 |
|||||||
|
|
A | 0.700 | GeneticVariation | CLINVAR | Mutations in BRIP1 confer high risk of ovarian cancer. | 21964575 | 2011 |