β-Thalassemia (BT) is a hereditary disorder characterized by altered hemoglobin beta-chain synthesis amenable to allogeneic HSC transplantation and HSC gene therapy.
Beta-thalassemia (β-thalassemia) minor is characterized by a mutation in one of the two β-globin genes (HBB) that produce the β-globin chains in the hemoglobin molecule.
We now report genetic correction of the beta hemoglobin (HBB) gene in iPSCs derived from a patient with a double heterozygote for hemoglobin E and β-thalassemia (HbE/β-thalassemia), the most common thalassemia syndrome in Thailand and Southeast Asia.
With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh.
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Cooley anemia (CA), or β-thalassemia major, is the most severe form of the disease and occurs when an individual has mutations in both copies of the adult β-globin gene.
HBB mutations can be roughly divided into two categories: those that cause a dysfunctional protein (such as sickle cell disease but also including varied diseases caused by high-affinity hemoglobins, low-affinity hemoglobins, and methemoglobinemia) and those that cause the insufficient production of HBB protein (β-thalassemia).
The β-haemoglobinopathies, such as sickle cell disease and β-thalassaemia, are caused by mutations in the β-globin (HBB) gene and affect millions of people worldwide.
Disorders resulting from mutations in the hemoglobin subunit beta gene (HBB; which encodes β-globin), mainly sickle cell disease (SCD) and β-thalassemia, become symptomatic postnatally as fetal γ-globin expression from two paralogous genes, hemoglobin subunit gamma 1 (HBG1) and HBG2, decreases and adult β-globin expression increases, thereby shifting red blood cell (RBC) hemoglobin from the fetal (referred to as HbF or α2γ2) to adult (referred to as HbA or α2β2) form.
Identification of novel microsatellite markers <1 Mb from the HBB gene and development of a single-tube pentadecaplex PCR panel of highly polymorphic markers for preimplantation genetic diagnosis of beta-thalassemia.
More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group.
As a basis for developing transgenic induced pluripotent stem cell therapies for thalassemia, β(654) induced pluripotent stem cells from a β(654) -thalassemia mouse transduced with the normal human β-globin gene, and the induced pluripotent stem cells with an erythroid-expressing reporter GFP were used to produce chimeric mice.
Here, we describe a robust process combining efficient generation of integration-free β-Thal iPSCs from the cells of patients and transcription activator-like effector nuclease (TALEN)-based universal correction of HBB mutations in situ.