Variant Gene DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1164484724
rs1164484724
0.790 0.240 9 137108433 stop gained C/T snv 7.0E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs119103263
rs119103263
0.827 0.240 1 11992659 missense variant C/T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs121434341
rs121434341
0.807 0.360 8 60855993 missense variant C/A;T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs121918455
rs121918455
0.695 0.440 12 112477720 missense variant A/C;G snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1421405659
rs1421405659
0.851 0.360 12 101642529 missense variant T/C;G snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1553354952
rs1553354952
0.882 0.200 1 224404492 missense variant C/T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1553354956
rs1553354956
0.882 0.200 1 224404504 missense variant A/C snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1553621496
rs1553621496
0.677 0.440 2 209976305 splice donor variant T/G snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1553655558
rs1553655558
0.752 0.360 2 229830831 frameshift variant A/- delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1553770577
rs1553770577
0.724 0.480 3 132675342 missense variant T/C snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555038111
rs1555038111
0.701 0.480 11 118478153 stop gained T/G snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555307370
rs1555307370
0.882 0.160 12 23740986 stop gained G/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555377415
rs1555377415
0.827 0.200 14 77027274 stop gained G/C snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555452127
rs1555452127
0.742 0.400 16 5079078 missense variant T/C snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555493029
rs1555493029
0.851 0.240 16 23406263 splice acceptor variant C/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555497604
rs1555497604
0.851 0.240 16 23452993 start lost A/G snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555580263
rs1555580263
0.827 0.240 17 63837200 stop gained -/AGGTAGAACCTTATCTGCCATCTTC delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555696625
rs1555696625
0.851 0.360 19 13025409 missense variant G/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555740650
rs1555740650
0.807 0.240 19 49596253 stop gained G/T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1556914274
rs1556914274
0.790 0.440 X 53537626 missense variant G/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1557182317
rs1557182317
EMD
0.925 0.160 X 154379790 frameshift variant -/T delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1557781252
rs1557781252
0.742 0.320 1 153816414 stop gained G/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1562127631
rs1562127631
0.742 0.360 6 78961751 frameshift variant C/- del
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1563183492
rs1563183492
0.708 0.520 7 70766248 missense variant C/T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1569146993
rs1569146993
0.851 0.320 22 42211700 frameshift variant -/C delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0