Overlap has been reported between the inherited PXE phenotype associated with ENPP1, ABCC6 or NT5E mutations and acquired PXE clinical manifestations associated with haemoglobinopathies induced by HBB mutations.
Background Thalassemia is a common hereditary anemia in humans, and beta thalassemia represents a group of recessively inherited hemoglobin disorders first described by Cooley and Lee and characterized by the abnormal synthesis of β-globin chain.
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Mutation in a Highly Conserved COOH-Terminal Residue of Krüppel-Like Factor 1 Associated with Elevated Hb F in a Compound Heterozygous β-Thalassemia Patient with a Nontransfusion-Dependent Thalassemia Phenotype.
A full understanding of the molecular mechanisms of epigenetic silencing of HbF expression should facilitate the development of more effective treatment of β-globin chainhemoglobinopathies.
Recent experimental evidence suggest that besides genomic variation within the human β-globin gene cluster, other variants in modifier genes residing outside the human β-globin gene cluster are significantly associated with response to hydroxyurea treatment in β-type hemoglobinopathies patients, deducted from the increase in fetal hemoglobin levels.
In the present study, we investigated how these pathways are used in β-thalassemia, a common hemoglobinopathy in which β-globin gene mutations cause the accumulation and precipitation of cytotoxic α-globin subunits.