Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs121908247
rs121908247
5 0.878 0.143 19 13235693 missense variant C/T snp 0.800 3 2000 2017
dbSNP: rs121908215
rs121908215
3 0.878 0.143 19 13359707 missense variant C/T snp 0.800 2 1997 2006
dbSNP: rs193922932
rs193922932
2 0.923 0.143 19 13207859 inframe insertion CCAGCAGCAGCAG/CCAGCAGCAGCAGCAG,CCAGCAGCAGCAGCAGCAG,CCAGCAGCAGCAGCAGCAGCAG,CCAGCAGCAGCAGCAGCAGCAGCAG,CCAGCAGCAGCAGCAGCAGCAGCAGCAG,CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG,CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG,CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG,CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG,CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG,CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG,CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG,C. microsatellite 0.700 10 1997 2013
dbSNP: rs397514035
rs397514035
2 0.923 0.143 19 13207895 coding sequence variant GCTG/G. microsatellite 0.700 10 1997 2013
dbSNP: rs121908217
rs121908217
7 0.846 0.107 19 13308452 missense variant C/T snp 4.0E-06 0.700 4 1999 2003
dbSNP: rs121908245
rs121908245
1 1.000 0.071 19 13332911 missense variant C/T snp 8.1E-06 0.700 1 2015 2015
dbSNP: rs121909326
rs121909326
3 0.878 0.143 19 13235219 missense variant A/G snp 0.700 1 2004 2004
dbSNP: rs863224852
rs863224852
2 0.923 0.143 19 13359680 missense variant C/T snp 0.700 1 2014 2014