Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs193922929
rs193922929
1 1.000 0.071 3 63912686 coding sequence variant GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/G. microsatellite 0.700 1 1997 1997