Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
---|---|---|---|---|---|---|---|---|---|---|
|
A | 0.800 | CausalMutation | CLINVAR | ||||||
|
A | 0.800 | CausalMutation | CLINVAR | ||||||
|
0.700 | GeneticVariation | UNIPROT | |||||||
|
TG | 0.700 | CausalMutation | CLINVAR | ||||||
|
GTGA | 0.700 | CausalMutation | CLINVAR | ||||||
|
CTG | 0.700 | CausalMutation | CLINVAR | ||||||
|
TCCCCCTGCTCCAAGCA | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | GeneticVariation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
GGCCCTGCTCAGCATCTGTCAGTGGAGACCACAGGCCCTGCTGCGGTGGGTGGAT | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | GeneticVariation | CLINVAR | ||||||
|
TGTCA | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
0.800 | GeneticVariation | UNIPROT | Mutations in the gene encoding the 3'-5' DNA exonuclease TREX1 cause Aicardi-Goutières syndrome at the AGS1 locus. | 16845398 | 2006 |
||||
|
A | 0.800 | CausalMutation | CLINVAR | Mutations in the gene encoding the 3'-5' DNA exonuclease TREX1 cause Aicardi-Goutières syndrome at the AGS1 locus. | 16845398 | 2006 |
|||
|
0.800 | GeneticVariation | UNIPROT | Mutations in the gene encoding the 3'-5' DNA exonuclease TREX1 cause Aicardi-Goutières syndrome at the AGS1 locus. | 16845398 | 2006 |
||||
|
0.800 | GeneticVariation | UNIPROT | Mutations in the gene encoding the 3'-5' DNA exonuclease TREX1 cause Aicardi-Goutières syndrome at the AGS1 locus. | 16845398 | 2006 |
||||
|
0.800 | GeneticVariation | UNIPROT | Mutations in the gene encoding the 3'-5' DNA exonuclease TREX1 cause Aicardi-Goutières syndrome at the AGS1 locus. | 16845398 | 2006 |
||||
|
0.700 | GeneticVariation | UNIPROT | Mutations in the gene encoding the 3'-5' DNA exonuclease TREX1 cause Aicardi-Goutières syndrome at the AGS1 locus. | 16845398 | 2006 |
||||
|
0.800 | GeneticVariation | UNIPROT | The crystal structure of TREX1 explains the 3' nucleotide specificity and reveals a polyproline II helix for protein partnering. | 17293595 | 2007 |
||||
|
A | 0.800 | CausalMutation | CLINVAR | The crystal structure of TREX1 explains the 3' nucleotide specificity and reveals a polyproline II helix for protein partnering. | 17293595 | 2007 |
|||
|
0.800 | GeneticVariation | UNIPROT | The crystal structure of TREX1 explains the 3' nucleotide specificity and reveals a polyproline II helix for protein partnering. | 17293595 | 2007 |