| Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
|---|---|---|---|---|---|---|---|---|---|---|
|
A | 0.800 | CausalMutation | CLINVAR | ||||||
|
A | 0.800 | CausalMutation | CLINVAR | ||||||
|
0.700 | GeneticVariation | UNIPROT | |||||||
|
TG | 0.700 | CausalMutation | CLINVAR | ||||||
|
GTGA | 0.700 | CausalMutation | CLINVAR | ||||||
|
CTG | 0.700 | CausalMutation | CLINVAR | ||||||
|
TCCCCCTGCTCCAAGCA | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | GeneticVariation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
GGCCCTGCTCAGCATCTGTCAGTGGAGACCACAGGCCCTGCTGCGGTGGGTGGAT | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | GeneticVariation | CLINVAR | ||||||
|
TGTCA | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | GeneticVariation | CLINVAR | A 44-year-old man with eye, kidney, and brain dysfunction. | 26691497 | 2016 |
|||
|
0.800 | GeneticVariation | UNIPROT | A de novo p.Asp18Asn mutation in TREX1 in a patient with Aicardi-Goutières syndrome. | 20799324 | 2010 |
||||
|
A | 0.800 | CausalMutation | CLINVAR | A de novo p.Asp18Asn mutation in TREX1 in a patient with Aicardi-Goutières syndrome. | 20799324 | 2010 |
|||
|
0.800 | GeneticVariation | UNIPROT | A de novo p.Asp18Asn mutation in TREX1 in a patient with Aicardi-Goutières syndrome. | 20799324 | 2010 |
||||
|
0.800 | GeneticVariation | UNIPROT | A de novo p.Asp18Asn mutation in TREX1 in a patient with Aicardi-Goutières syndrome. | 20799324 | 2010 |
||||
|
0.800 | GeneticVariation | UNIPROT | A de novo p.Asp18Asn mutation in TREX1 in a patient with Aicardi-Goutières syndrome. | 20799324 | 2010 |
||||
|
0.700 | GeneticVariation | UNIPROT | A de novo p.Asp18Asn mutation in TREX1 in a patient with Aicardi-Goutières syndrome. | 20799324 | 2010 |
||||
|
CA | 0.700 | CausalMutation | CLINVAR | A homozygous NOTCH3 mutation p.R544C and a heterozygous TREX1 variant p.C99MfsX3 in a family with hereditary small vessel disease of the brain. | 23602593 | 2013 |
|||
|
A | 0.800 | CausalMutation | CLINVAR | A mutation in TREX1 that impairs susceptibility to granzyme A-mediated cell death underlies familial chilblain lupus. | 17440703 | 2007 |