| Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
|---|---|---|---|---|---|---|---|---|---|---|
|
0.800 | GeneticVariation | UNIPROT | A novel loss-of-function mutation of GATA3 (p.R299Q) in a Japanese family with Hypoparathyroidism, Deafness, and Renal Dysplasia (HDR) syndrome. | 26514990 | 2015 |
||||
|
0.800 | GeneticVariation | UNIPROT | GATA3 abnormalities and the phenotypic spectrum of HDR syndrome. | 11389161 | 2001 |
||||
|
0.800 | GeneticVariation | UNIPROT | GATA3 haplo-insufficiency causes human HDR syndrome. | 10935639 | 2000 |
||||
|
A | 0.800 | CausalMutation | CLINVAR | ||||||
|
0.710 | GeneticVariation | BEFREE | Together with other reported cases, this study highlights the variability of HDR syndrome symptoms in individuals with the p.Arg367* mutation, emphasizing the importance of molecular analyses for correct diagnosis. | 30534854 | 2020 |
||||
|
T | 0.710 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | GeneticVariation | CLINVAR | ||||||
|
GCTTACTTCCC | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
TACCCGCCCTACGTGCCCACCACCCCATCAGCACTC | 0.700 | CausalMutation | CLINVAR | ||||||
|
0.010 | GeneticVariation | BEFREE | These findings indicate that not only haploinsufficiency of GATA3 but also the dominant-negative effect of Cys321Ser-mutated GATA3 might have been responsible for the HDR syndrome phenotype of our patient. | 21120445 | 2011 |