| Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
|---|---|---|---|---|---|---|---|---|---|---|
|
0.800 | GeneticVariation | UNIPROT | Molecular findings and clinical data in a cohort of 150 patients with anophthalmia/microphthalmia. | 24033328 | 2014 |
||||
|
0.800 | GeneticVariation | UNIPROT | Mutations in SOX2 cause anophthalmia. | 12612584 | 2003 |
||||
|
C | 0.800 | CausalMutation | CLINVAR | ||||||
|
ACCTCGG | 0.700 | CausalMutation | CLINVAR | A novel heterozygous SOX2 mutation causing congenital bilateral anophthalmia, hypogonadotropic hypogonadism and growth hormone deficiency. | 24211324 | 2014 |
|||
|
ACCTCGG | 0.700 | CausalMutation | CLINVAR | Clinical and mutation analysis of 51 probands with anophthalmia and/or severe microphthalmia from a single center. | 24498598 | 2013 |
|||
|
G | 0.700 | CausalMutation | CLINVAR | Parent-of-origin effects in SOX2 anophthalmia syndrome. | 22171155 | 2011 |
|||
|
ACCTCGG | 0.700 | CausalMutation | CLINVAR | Novel SOX2 mutations and genotype-phenotype correlation in anophthalmia and microphthalmia. | 19921648 | 2009 |
|||
|
G | 0.700 | CausalMutation | CLINVAR | Novel SOX2 mutations and genotype-phenotype correlation in anophthalmia and microphthalmia. | 19921648 | 2009 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
TC | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
GGGCGGCGGCGGCAACTCCACCGC | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
CGG | 0.700 | CausalMutation | CLINVAR | ||||||
|
AA | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR |