| Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
|---|---|---|---|---|---|---|---|---|---|---|
|
G | 0.800 | CausalMutation | CLINVAR | ||||||
|
C | 0.800 | CausalMutation | CLINVAR | ||||||
|
A | 0.800 | CausalMutation | CLINVAR | ||||||
|
A | 0.800 | CausalMutation | CLINVAR | ||||||
|
T | 0.800 | CausalMutation | CLINVAR | ||||||
|
A | 0.800 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | GeneticVariation | CLINVAR | A prospective evaluation of whole-exome sequencing as a first-tier molecular test in infants with suspected monogenic disorders. | 26938784 | 2016 |
|||
|
G | 0.700 | GeneticVariation | CLINVAR | Structural basis for PHDVC5HCHNSD1-C2HRNizp1 interaction: implications for Sotos syndrome. | 26896805 | 2016 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | Molecular diagnostic experience of whole-exome sequencing in adult patients. | 26633545 | 2016 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | Molecular diagnostic experience of whole-exome sequencing in adult patients. | 26633545 | 2016 |
|||
|
GC | 0.700 | CausalMutation | CLINVAR | Exome Sequence Analysis Suggests that Genetic Burden Contributes to Phenotypic Variability and Complex Neuropathy. | 26257172 | 2015 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | Heterogeneity of NSD1 alterations in 116 patients with Sotos syndrome. | 17565729 | 2007 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | Genotype-phenotype associations in Sotos syndrome: an analysis of 266 individuals with NSD1 aberrations. | 15942875 | 2005 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | Mutation analysis of the NSD1 gene in a group of 59 patients with congenital overgrowth. | 15742365 | 2005 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | Spectrum of NSD1 mutations in Sotos and Weaver syndromes. | 12807965 | 2003 |
|||
|
G | 0.700 | CausalMutation | CLINVAR | Identification of eight novel NSD1 mutations in Sotos syndrome. | 14627693 | 2003 |
|||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
CGTTCAGACTGTGTTACTAG | 0.700 | GeneticVariation | CLINVAR |