Disease Score gda Association Type Type Original DB Sentence supporting the association PMID PMID Year
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 GeneticVariation group BEFREE Hemoglobinopathies such as beta-thalassemia and sickle cell disease (SCD) are inherited disorders that are caused by mutations in beta-globin chain. 30124006 2019
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 GeneticVariation group BEFREE Genetic lesions of the β-globin gene result in haemoglobinopathies such as β-thalassemia and sickle cell disease. 30616747 2019
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 GeneticVariation group BEFREE Overlap has been reported between the inherited PXE phenotype associated with ENPP1, ABCC6 or NT5E mutations and acquired PXE clinical manifestations associated with haemoglobinopathies induced by HBB mutations. 31646622 2019
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 GeneticVariation group BEFREE Background Thalassemia is a common hereditary anemia in humans, and beta thalassemia represents a group of recessively inherited hemoglobin disorders first described by Cooley and Lee and characterized by the abnormal synthesis of β-globin chain. 28948115 2017
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 CausalMutation group CLINVAR Cross-Sectional Study for the Detection of Mutations in the Beta-Globin Gene Among Patients with Hemoglobinopathies in the Bengali Population. 27828729 2017
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 GeneticVariation group BEFREE Mutations in the HBB gene are responsible for several serious hemoglobinopathies, such as sickle cell anemia and β-thalassemia. 28379995 2017
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 CausalMutation group CLINVAR Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil. 28366028 2017
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 CausalMutation group CLINVAR Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. 28603845 2017
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 GeneticVariation group CLINVAR Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations. 26635043 2016
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 CausalMutation group CLINVAR Report on Ten Years' Experience of Premarital Hemoglobinopathy Screening at a Center in Antalya, Southern Turkey. 27207683 2016
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 CausalMutation group CLINVAR Mutation in a Highly Conserved COOH-Terminal Residue of Krüppel-Like Factor 1 Associated with Elevated Hb F in a Compound Heterozygous β-Thalassemia Patient with a Nontransfusion-Dependent Thalassemia Phenotype. 27821015 2016
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 CausalMutation group CLINVAR The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon. 26372288 2016
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 Biomarker group BEFREE A full understanding of the molecular mechanisms of epigenetic silencing of HbF expression should facilitate the development of more effective treatment of β-globin chain hemoglobinopathies. 24880147 2015
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 GeneticVariation group BEFREE Recent experimental evidence suggest that besides genomic variation within the human β-globin gene cluster, other variants in modifier genes residing outside the human β-globin gene cluster are significantly associated with response to hydroxyurea treatment in β-type hemoglobinopathies patients, deducted from the increase in fetal hemoglobin levels. 25155936 2014
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 CausalMutation group CLINVAR Spectrum of Beta Globin Gene Mutations in Egyptian Children with β-Thalassemia. 25408857 2014
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 CausalMutation group CLINVAR Hb Knossos: HBB:c.82G>T Associated with HBB:c.315+1G>A Beta Zero Mutation Causes Thalassemia Intermedia. 25332589 2014
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 CausalMutation group CLINVAR Molecular update of β-thalassemia mutations in the Syrian population: identification of rare β-thalassemia mutations. 24828949 2014
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 CausalMutation group CLINVAR High resolution melting analysis: a rapid screening and typing tool for common β-thalassemia mutation in Chinese population. 25089872 2014
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 GeneticVariation group BEFREE Mutations in the β-globin gene (HBB) cause haemoglobinopathies where current treatments have serious limitations. 24590875 2014
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 GeneticVariation group BEFREE The hemoglobinopathies encompass a heterogeneous group of disorders associated with mutations in both the alpha-globin and beta-globin genes. 23590658 2013
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 CausalMutation group CLINVAR Prenatal and newborn screening for hemoglobinopathies. 23590658 2013
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 CausalMutation group CLINVAR Hemoglobinopathy: molecular epidemiological characteristics and health effects on Hakka people in the Meizhou region, southern China. 23383304 2013
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 GeneticVariation group CLINVAR Genotyping of beta thalassemia trait by high-resolution DNA melting analysis. 24450243 2013
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 CausalMutation group CLINVAR The spectrum of β-thalassemia mutations in Gaza Strip, Palestine. 23321370 2013
CUI: C0019045
Disease: Hemoglobinopathies
Hemoglobinopathies
0.500 GeneticVariation group BEFREE In the present study, we investigated how these pathways are used in β-thalassemia, a common hemoglobinopathy in which β-globin gene mutations cause the accumulation and precipitation of cytotoxic α-globin subunits. 22427201 2012