TANK, TRAF family member associated NFKB activator, 10010
N. diseases: 34; N. variants: 9
Source: ALL
Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
1.000 | 0.040 | 2 | 161213814 | intron variant | G/A | snv | 0.43 |
|
Endocrine System Diseases | 0.700 | 1.000 | 1 | 2019 | 2019 | |||||||
|
1.000 | 0.040 | 2 | 161213814 | intron variant | G/A | snv | 0.43 |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 1 | 2019 | 2019 | |||||||
|
2 | 161203458 | intron variant | A/T | snv | 0.48 | 0.43 |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 1 | 2018 | 2018 | ||||||||
|
2 | 161155624 | intron variant | T/G | snv | 0.26 |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 1 | 2019 | 2019 | |||||||||
|
1.000 | 0.120 | 2 | 161192690 | intron variant | A/G | snv | 0.15 |
|
Neoplasms; Immune System Diseases; Hemic and Lymphatic Diseases | 0.010 | 1.000 | 1 | 2009 | 2009 | |||||||
|
2 | 161235325 | intron variant | T/A;C;G | snv | 2.7E-05; 0.48 |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 1 | 2018 | 2018 | |||||||||
|
0.882 | 0.120 | 2 | 161138615 | intron variant | C/A;T | snv |
|
Digestive System Diseases; Infections | 0.010 | 1.000 | 1 | 2012 | 2012 | ||||||||
|
0.882 | 0.120 | 2 | 161138615 | intron variant | C/A;T | snv |
|
Pathological Conditions, Signs and Symptoms; Digestive System Diseases | 0.010 | 1.000 | 1 | 2012 | 2012 | ||||||||
|
0.882 | 0.120 | 2 | 161138615 | intron variant | C/A;T | snv |
|
Digestive System Diseases | 0.010 | 1.000 | 1 | 2012 | 2012 | ||||||||
|
1.000 | 0.040 | 2 | 161226860 | intron variant | -/GGTAATAAACAACCATGAGGTCTTTTTCTTTTGTCAATATACAACGTGATTATACTGAGAAG | delins |
|
Eye Diseases | 0.010 | 1.000 | 1 | 2019 | 2019 | ||||||||
|
1.000 | 2 | 161172602 | intron variant | T/G | snv | 0.11 |
|
Nervous System Diseases | 0.700 | 1.000 | 1 | 2014 | 2014 | ||||||||
|
1.000 | 2 | 161172602 | intron variant | T/G | snv | 0.11 |
|
0.700 | 1.000 | 1 | 2014 | 2014 | |||||||||
|
1.000 | 2 | 161172602 | intron variant | T/G | snv | 0.11 |
|
0.700 | 1.000 | 1 | 2014 | 2014 | |||||||||
|
1.000 | 2 | 161172602 | intron variant | T/G | snv | 0.11 |
|
0.700 | 1.000 | 1 | 2014 | 2014 | |||||||||
|
1.000 | 2 | 161172602 | intron variant | T/G | snv | 0.11 |
|
0.700 | 1.000 | 1 | 2014 | 2014 | |||||||||
|
2 | 161236129 | 3 prime UTR variant | G/A | snv | 0.42 |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 2 | 2017 | 2019 |