Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1447189148
rs1447189148
1.000 0.080 19 39502939 stop gained C/A;G snv 1.6E-05
CUI: C0265343
Disease: Jarcho-Levin syndrome
Jarcho-Levin syndrome
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs786200899
rs786200899
0.925 0.080 19 39502998 frameshift variant -/GCGGT delins
CUI: C0265343
Disease: Jarcho-Levin syndrome
Jarcho-Levin syndrome
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 1.000 2 2000 2004
dbSNP: rs104894675
rs104894675
1.000 0.080 19 39504130 stop gained C/T snv 3.2E-05 1.4E-05
CUI: C0265343
Disease: Jarcho-Levin syndrome
Jarcho-Levin syndrome
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs786200900
rs786200900
1.000 0.080 19 39505303 frameshift variant AT/- del 2.0E-05 4.2E-05
CUI: C0265343
Disease: Jarcho-Levin syndrome
Jarcho-Levin syndrome
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs104894674
rs104894674
1.000 0.080 19 39507099 missense variant G/A snv
CUI: C0265343
Disease: Jarcho-Levin syndrome
Jarcho-Levin syndrome
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.800 1.000 1 2000 2000
dbSNP: rs777791545
rs777791545
1.000 0.080 19 39507230 frameshift variant GACCCGTGCGCCGCGCG/-;GACCCGTGCGCCGCGCGGACCCGTGCGCCGCGCG delins
CUI: C0265343
Disease: Jarcho-Levin syndrome
Jarcho-Levin syndrome
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs786200903
rs786200903
1.000 0.080 19 39507385 frameshift variant G/- del
CUI: C0265343
Disease: Jarcho-Levin syndrome
Jarcho-Levin syndrome
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs104894676
rs104894676
1.000 0.080 19 39507456 missense variant G/A snv 2.0E-05
CUI: C0265343
Disease: Jarcho-Levin syndrome
Jarcho-Levin syndrome
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0