DLL3, delta like canonical Notch ligand 3, 10683
N. diseases: 134; N. variants: 9
Source: ALL
Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
1.000 | 0.080 | 19 | 39504130 | stop gained | C/T | snv | 3.2E-05 | 1.4E-05 |
|
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||
|
1.000 | 0.080 | 19 | 39507456 | missense variant | G/A | snv | 2.0E-05 |
|
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | ||||||||||
|
1.000 | 0.080 | 19 | 39502939 | stop gained | C/A;G | snv | 1.6E-05 |
|
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | ||||||||||
|
1.000 | 0.080 | 19 | 39507230 | frameshift variant | GACCCGTGCGCCGCGCG/-;GACCCGTGCGCCGCGCGGACCCGTGCGCCGCGCG | delins |
|
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 19 | 39505303 | frameshift variant | AT/- | del | 2.0E-05 | 4.2E-05 |
|
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||
|
1.000 | 0.080 | 19 | 39507385 | frameshift variant | G/- | del |
|
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 19 | 39507099 | missense variant | G/A | snv |
|
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.800 | 1.000 | 1 | 2000 | 2000 | ||||||||
|
0.925 | 0.080 | 19 | 39502998 | frameshift variant | -/GCGGT | delins |
|
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 1.000 | 2 | 2000 | 2004 |