TXNL4A, thioredoxin like 4A, 10907

N. diseases: 39; N. variants: 6
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs535089924
rs535089924 		1.000 0.240 18 79988581 5 prime UTR variant CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATG/-;CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATG;CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATG delins 4.7E-03
CUI: C1837822
Disease: Burn-Mckeown syndrome
Burn-Mckeown syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases; Cardiovascular Diseases 0.700 1.000 1 2014 2014
dbSNP: rs727502793
rs727502793 		1.000 0.240 18 79973765 stop gained C/A;T snv 8.0E-06
CUI: C1837822
Disease: Burn-Mckeown syndrome
Burn-Mckeown syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases; Cardiovascular Diseases 0.700 1.000 1 2014 2014
dbSNP: rs727502794
rs727502794 		1.000 0.240 18 79988356 stop gained G/A snv
CUI: C1837822
Disease: Burn-Mckeown syndrome
Burn-Mckeown syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases; Cardiovascular Diseases 0.700 1.000 1 2014 2014
dbSNP: rs727502795
rs727502795 		1.000 0.240 18 79988262 frameshift variant A/- del
CUI: C1837822
Disease: Burn-Mckeown syndrome
Burn-Mckeown syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases; Cardiovascular Diseases 0.700 1.000 1 2014 2014
dbSNP: rs786205699
rs786205699 		1.000 0.240 18 79988604 intron variant CGCGCTAGCGCCGTGCGTGCTGACGGCATGTGCG/- delins 1.4E-04
CUI: C1837822
Disease: Burn-Mckeown syndrome
Burn-Mckeown syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases; Cardiovascular Diseases 0.700 1.000 1 2014 2014
dbSNP: rs879255559
rs879255559 		1.000 0.240 18 79988237 splice region variant T/C snv
CUI: C1837822
Disease: Burn-Mckeown syndrome
Burn-Mckeown syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases; Cardiovascular Diseases 0.700 0