CSTB, cystatin B, 1476

N. diseases: 155; N. variants: 14
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs312262708
rs312262708 		1.000 0.080 21 43774677 missense variant C/T snv 1.4E-05
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs386833439
rs386833439 		1.000 0.080 21 43774701 stop gained G/T snv 7.0E-06
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs386833441
rs386833441 		1.000 0.080 21 43774332 splice acceptor variant T/C snv
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs545986367
rs545986367 		0.882 0.080 21 43774690 stop gained G/A snv 3.2E-05 7.0E-06
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs74315442
rs74315442 		0.851 0.200 21 43774297 stop gained G/A snv 4.0E-05 2.1E-05
CUI: C0241816
Disease: Global brain atrophy
Global brain atrophy 		0.700 0
dbSNP: rs74315442
rs74315442 		0.851 0.200 21 43774297 stop gained G/A snv 4.0E-05 2.1E-05
CUI: C0013384
Disease: Dyskinetic syndrome
Dyskinetic syndrome 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0
dbSNP: rs74315442
rs74315442 		0.851 0.200 21 43774297 stop gained G/A snv 4.0E-05 2.1E-05
CUI: C0013421
Disease: Dystonia
Dystonia 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0
dbSNP: rs74315442
rs74315442 		0.851 0.200 21 43774297 stop gained G/A snv 4.0E-05 2.1E-05
CUI: C1837397
Disease: Severe global developmental delay
Severe global developmental delay 		0.700 0
dbSNP: rs74315442
rs74315442 		0.851 0.200 21 43774297 stop gained G/A snv 4.0E-05 2.1E-05
CUI: C0036857
Disease: Severe intellectual disability
Severe intellectual disability 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs74315442
rs74315442 		0.851 0.200 21 43774297 stop gained G/A snv 4.0E-05 2.1E-05
CUI: C1854301
Disease: Motor delay
Motor delay 		Mental Disorders 0.700 0
dbSNP: rs74315442
rs74315442 		0.851 0.200 21 43774297 stop gained G/A snv 4.0E-05 2.1E-05
CUI: C1861866
Disease: Aplasia/Hypoplasia of the corpus callosum
Aplasia/Hypoplasia of the corpus callosum 		0.700 0
dbSNP: rs74315442
rs74315442 		0.851 0.200 21 43774297 stop gained G/A snv 4.0E-05 2.1E-05
CUI: C1850456
Disease: Progressive microcephaly
Progressive microcephaly 		0.700 0
dbSNP: rs796943858
rs796943858 		0.882 0.080 21 43774280 frameshift variant GA/- delins 2.0E-05 5.6E-05
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs864309482
rs864309482 		1.000 0.080 21 43774637 splice donor variant CTCCTGAGGCCCACACTCTA/TT delins
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0