EYA1, EYA transcriptional coactivator and phosphatase 1, 2138
N. diseases: 168; N. variants: 36
Source: ALL
Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
0.882 | 0.040 | 8 | 71211239 | stop gained | C/A | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||||
|
1.000 | 0.040 | 8 | 71215443 | missense variant | A/G | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||||
|
1.000 | 0.040 | 8 | 71271802 | stop gained | G/A;C | snv | 4.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | ||||||||||
|
1.000 | 0.040 | 8 | 71211170 | stop gained | G/A;C | snv | 4.0E-06 | 2.1E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||
|
1.000 | 0.040 | 8 | 71299175 | splice acceptor variant | GAGCTGTTATAATACTGTGCGTACTGACCCTGGCCAAAACTGGGATAAGACGGATAGTCCTACCAAATCAAACC/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||||
|
1.000 | 0.040 | 8 | 71317576 | frameshift variant | C/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||||
|
1.000 | 0.040 | 8 | 71216722 | frameshift variant | CT/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||||
|
1.000 | 0.040 | 8 | 71269746 | stop gained | A/C | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||||
|
1.000 | 0.040 | 8 | 71269774 | frameshift variant | AGGA/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||||
|
1.000 | 0.040 | 8 | 71299191 | stop gained | G/A | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||||
|
1.000 | 0.040 | 8 | 71322242 | stop gained | G/A;T | snv | 4.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | ||||||||||
|
1.000 | 0.040 | 8 | 71211156 | frameshift variant | CTTT/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 0 | |||||||||||
|
1.000 | 0.040 | 8 | 71216733 | missense variant | C/T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.800 | 1.000 | 11 | 1997 | 2017 | ||||||||
|
0.882 | 0.040 | 8 | 71216776 | missense variant | C/T | snv | 1.4E-04 | 1.4E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.710 | 1.000 | 7 | 1997 | 2018 | ||||||
|
1.000 | 0.040 | 8 | 71215630 | missense variant | A/G | snv | 4.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.800 | 1.000 | 6 | 1997 | 2011 | |||||||
|
1.000 | 0.040 | 8 | 71215470 | missense variant | A/C | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.800 | 1.000 | 6 | 1997 | 2011 | ||||||||
|
0.882 | 0.040 | 8 | 71199371 | missense variant | A/G | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.800 | 1.000 | 6 | 1997 | 2011 | ||||||||
|
0.925 | 0.040 | 8 | 71244662 | stop gained | G/A;T | snv | 4.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 1.000 | 4 | 2006 | 2016 | |||||||
|
1.000 | 0.040 | 8 | 71271835 | stop gained | G/A | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 1.000 | 2 | 2000 | 2008 | ||||||||
|
1.000 | 0.040 | 8 | 71216853 | splice acceptor variant | C/T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 1.000 | 1 | 2008 | 2008 | ||||||||
|
0.882 | 0.120 | 8 | 71271753 | splice region variant | C/T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities | 0.700 | 1.000 | 1 | 2017 | 2017 |