Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1060499603
rs1060499603
0.882 0.040 8 71211239 stop gained C/A snv
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs112340154
rs112340154
1.000 0.040 8 71215443 missense variant A/G snv
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs121909195
rs121909195
1.000 0.040 8 71271802 stop gained G/A;C snv 4.0E-06
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs1481254965
rs1481254965
1.000 0.040 8 71211170 stop gained G/A;C snv 4.0E-06 2.1E-05
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs1554541834
rs1554541834
1.000 0.040 8 71299175 splice acceptor variant GAGCTGTTATAATACTGTGCGTACTGACCCTGGCCAAAACTGGGATAAGACGGATAGTCCTACCAAATCAAACC/- del
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs1554548840
rs1554548840
1.000 0.040 8 71317576 frameshift variant C/- delins
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs1554596461
rs1554596461
1.000 0.040 8 71216722 frameshift variant CT/- delins
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs1554615511
rs1554615511
1.000 0.040 8 71269746 stop gained A/C snv
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs1554615536
rs1554615536
1.000 0.040 8 71269774 frameshift variant AGGA/- delins
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs1563422304
rs1563422304
1.000 0.040 8 71299191 stop gained G/A snv
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs200164773
rs200164773
1.000 0.040 8 71322242 stop gained G/A;T snv 4.0E-06
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs606231355
rs606231355
1.000 0.040 8 71211156 frameshift variant CTTT/- del
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 0
dbSNP: rs121909196
rs121909196
1.000 0.040 8 71216733 missense variant C/T snv
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.800 1.000 11 1997 2017
dbSNP: rs121909199
rs121909199
0.882 0.040 8 71216776 missense variant C/T snv 1.4E-04 1.4E-05
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.710 1.000 7 1997 2018
dbSNP: rs121909200
rs121909200
1.000 0.040 8 71215630 missense variant A/G snv 4.0E-06
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.800 1.000 6 1997 2011
dbSNP: rs121909201
rs121909201
1.000 0.040 8 71215470 missense variant A/C snv
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.800 1.000 6 1997 2011
dbSNP: rs397517920
rs397517920
0.882 0.040 8 71199371 missense variant A/G snv
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.800 1.000 6 1997 2011
dbSNP: rs1131691667
rs1131691667
1.000 0.040 8 71271835 stop gained G/A snv
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 1.000 2 2000 2008
dbSNP: rs121909202
rs121909202
0.925 0.040 8 71244662 stop gained G/A;T snv 4.0E-06
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 1.000 4 2006 2016
dbSNP: rs1563634200
rs1563634200
1.000 0.040 8 71216853 splice acceptor variant C/T snv
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 1.000 1 2008 2008
dbSNP: rs606231357
rs606231357
0.882 0.120 8 71271753 splice region variant C/T snv
CUI: C4551702
Disease: Branchiootorenal Syndrome 1
Branchiootorenal Syndrome 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities 0.700 1.000 1 2017 2017