GJB2, gap junction protein beta 2, 2706
N. diseases: 392; N. variants: 132
Source: ALL
Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
0.925 | 0.120 | 13 | 20188932 | frameshift variant | TCTA/- | delins | 4.8E-05 | 2.1E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||
|
1.000 | 0.120 | 13 | 20188949 | frameshift variant | CA/- | delins | 4.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | ||||||||||
|
0.763 | 0.280 | 13 | 20188965 | missense variant | T/C | snv | 9.6E-05 | 1.8E-04 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||
|
1.000 | 0.120 | 13 | 20188976 | stop gained | -/AAATTCCAGACACTGCAATCATGAACACTGTGAAGACAGTCTTCTC | delins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||||
|
1.000 | 0.120 | 13 | 20188982 | stop gained | TCCAGACAC/GAATGTCATGAACACTG | delins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||||
|
0.752 | 0.280 | 13 | 20189031 | missense variant | C/G;T | snv | 6.0E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.730 | 0.667 | 3 | 2010 | 2017 | |||||||
|
1.000 | 0.120 | 13 | 20189032 | missense variant | G/A | snv | 1.2E-05 | 2.8E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||
|
0.776 | 0.280 | 13 | 20189076 | missense variant | C/T | snv | 8.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.010 | 1.000 | 1 | 2014 | 2014 | |||||||
|
13 | 20189108 | stop gained | G/A;C | snv | 1.2E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | ||||||||||||
|
13 | 20189144 | synonymous variant | G/A | snv | 4.0E-06 | 7.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.010 | 1.000 | 1 | 2002 | 2002 | ||||||||
|
0.763 | 0.280 | 13 | 20189155 | missense variant | G/A | snv | 1.2E-04 | 2.0E-04 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.720 | 1.000 | 2 | 2005 | 2019 | ||||||
|
0.763 | 0.280 | 13 | 20189166 | missense variant | C/T | snv | 2.9E-04 | 4.6E-04 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||
|
13 | 20189186 | synonymous variant | C/T | snv | 4.0E-06 | 7.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.010 | 1.000 | 1 | 2001 | 2001 | ||||||||
|
1.000 | 0.120 | 13 | 20189202 | missense variant | C/A;T | snv | 2.8E-04; 1.4E-02 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.010 | 1.000 | 1 | 2010 | 2010 | |||||||
|
1.000 | 0.120 | 13 | 20189212 | stop gained | G/A | snv | 8.4E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.710 | 1.000 | 1 | 2017 | 2017 | |||||||
|
0.925 | 0.120 | 13 | 20189217 | missense variant | T/A;G | snv | 6.0E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | ||||||||||
|
1.000 | 0.120 | 13 | 20189222 | inframe deletion | CTC/- | delins | 7.2E-05 | 9.1E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||
|
0.925 | 0.200 | 13 | 20189241 | missense variant | T/C | snv | 1.5E-02 | 5.1E-03 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.030 | 1.000 | 3 | 2009 | 2015 | ||||||
|
1.000 | 0.120 | 13 | 20189247 | frameshift variant | TT/- | delins | 8.0E-06 | 1.4E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||
|
0.925 | 0.120 | 13 | 20189256 | frameshift variant | CTTGATGAACTTCC/- | delins | 1.5E-04 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | ||||||||||
|
1.000 | 0.120 | 13 | 20189284 | missense variant | G/A | snv | 1.2E-05 | 2.8E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||
|
0.763 | 0.280 | 13 | 20189299 | missense variant | C/T | snv | 4.8E-05 | 7.7E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||
|
0.695 | 0.440 | 13 | 20189313 | missense variant | A/G | snv | 6.4E-04 | 6.4E-04 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.720 | 1.000 | 2 | 2005 | 2007 | ||||||
|
0.827 | 0.120 | 13 | 20189332 | missense variant | C/A;G;T | snv | 1.6E-05; 3.6E-05; 4.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | ||||||||||
|
1.000 | 0.120 | 13 | 20189336 | missense variant | G/C | snv | 8.0E-06 | 7.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.010 | 1.000 | 1 | 2002 | 2002 |