GJB2, gap junction protein beta 2, 2706

N. diseases: 392; N. variants: 132
Disease: hearing impairment ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs104894396
rs104894396 		0.672 0.400 13 20189511 stop gained C/T snv 5.8E-04 1.1E-04
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.710 1.000 1 2019 2019
dbSNP: rs104894398
rs104894398 		0.776 0.280 13 20189443 stop gained C/A;T snv 1.3E-04; 4.0E-06
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs104894402
rs104894402 		0.882 0.200 13 20189359 missense variant G/A;C snv
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.720 1.000 2 2000 2001
dbSNP: rs104894407
rs104894407 		0.925 0.120 13 20189450 stop gained C/G;T snv 2.8E-05
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.710 1.000 1 2001 2001
dbSNP: rs104894408
rs104894408 		0.742 0.280 13 20189548 missense variant C/A;G snv 5.1E-04
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs104894409
rs104894409 		0.827 0.120 13 20189332 missense variant C/A;G;T snv 1.6E-05; 3.6E-05; 4.0E-06
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1057517519
rs1057517519 		0.925 0.120 13 20189523 missense variant A/G snv
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs111033190
rs111033190 		0.925 0.120 13 20189487 missense variant C/A;T snv 3.2E-05; 4.0E-06
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs111033196
rs111033196 		1.000 0.120 13 20189202 missense variant C/A;T snv 2.8E-04; 1.4E-02
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.010 1.000 1 2010 2010
dbSNP: rs111033253
rs111033253 		0.925 0.120 13 20189256 frameshift variant CTTGATGAACTTCC/- delins 1.5E-04
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs111033293
rs111033293 		0.763 0.280 13 20189581 start lost T/A;C snv 3.6E-05 4.2E-05
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.010 1.000 1 2014 2014
dbSNP: rs111033294
rs111033294 		0.763 0.280 13 20188965 missense variant T/C snv 9.6E-05 1.8E-04
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs111033295
rs111033295 		0.925 0.120 13 20189217 missense variant T/A;G snv 6.0E-05
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs111033297
rs111033297 		1.000 0.120 13 20189413 stop gained G/A snv 2.8E-05 2.8E-05
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs111033299
rs111033299 		0.763 0.280 13 20189299 missense variant C/T snv 4.8E-05 7.7E-05
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs111033335
rs111033335 		1.000 0.120 13 20188982 stop gained TCCAGACAC/GAATGTCATGAACACTG delins
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs111033361
rs111033361 		13 20189355 missense variant A/G snv 2.0E-05 7.0E-06
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.010 1.000 1 2009 2009
dbSNP: rs143343083
rs143343083 		1.000 0.120 13 20189284 missense variant G/A snv 1.2E-05 2.8E-05
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1476034902
rs1476034902 		13 20189542 missense variant T/C snv 1.4E-05
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.010 1.000 1 2006 2006
dbSNP: rs1566528185
rs1566528185 		1.000 0.120 13 20188976 stop gained -/AAATTCCAGACACTGCAATCATGAACACTGTGAAGACAGTCTTCTC delins
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1801002
rs1801002 		0.925 0.120 13 20189547 missense variant C/A;T snv 9.2E-05; 7.2E-05
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs2274083
rs2274083 		0.925 0.200 13 20189241 missense variant T/C snv 1.5E-02 5.1E-03
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.030 1.000 3 2009 2015
dbSNP: rs2274084
rs2274084 		0.882 0.240 13 20189503 missense variant C/T snv 5.4E-02 2.2E-02
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.020 0.500 2 2005 2009
dbSNP: rs28931593
rs28931593 		0.776 0.200 13 20189358 missense variant C/T snv 7.0E-06
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.020 1.000 2 2002 2014
dbSNP: rs28931594
rs28931594 		0.790 0.280 13 20189434 missense variant C/A;T snv
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0