Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs28928904
rs28928904 		0.925 0.120 7 150951615 missense variant A/C;G;T snv 4.0E-06
CUI: C3150943
Disease: Long Qt Syndrome 2
Long Qt Syndrome 2 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.800 0
dbSNP: rs28928905
rs28928905 		0.851 0.120 7 150952514 missense variant C/G;T snv
CUI: C3150943
Disease: Long Qt Syndrome 2
Long Qt Syndrome 2 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.800 0
dbSNP: rs1057520558
rs1057520558 		1.000 0.120 7 150947453 stop gained G/C snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1060500661
rs1060500661 		1.000 0.120 7 150951698 frameshift variant G/- delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1060500662
rs1060500662 		1.000 0.120 7 150950200 frameshift variant -/TC delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1064793434
rs1064793434 		1.000 0.120 7 150948978 frameshift variant C/- delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1064794793
rs1064794793 		1.000 0.120 7 150950983 stop gained G/A snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1085307620
rs1085307620 		1.000 0.120 7 150958306 frameshift variant TGCCA/G delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1131692183
rs1131692183 		1.000 0.120 7 150948456 frameshift variant -/CCTGC delins
CUI: C3150943
Disease: Long Qt Syndrome 2
Long Qt Syndrome 2 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1131692327
rs1131692327 		1.000 0.120 7 150947632 frameshift variant TTCTC/- delins
CUI: C3150943
Disease: Long Qt Syndrome 2
Long Qt Syndrome 2 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs121912504
rs121912504 		0.851 0.200 7 150951711 missense variant G/A snv
CUI: C0028754
Disease: Obesity
Obesity 		Pathological Conditions, Signs and Symptoms; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs121912504
rs121912504 		0.851 0.200 7 150951711 missense variant G/A snv
CUI: C0151878
Disease: Prolonged QT interval
Prolonged QT interval 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs121912508
rs121912508 		0.925 0.120 7 150951649 missense variant G/A snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs121912509
rs121912509 		1.000 0.120 7 150947477 stop gained C/G;T snv 5.2E-06
CUI: C3150943
Disease: Long Qt Syndrome 2
Long Qt Syndrome 2 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs121912514
rs121912514 		0.925 0.120 7 150947729 missense variant G/A;T snv 6.0E-05; 6.0E-06
CUI: C3277700
Disease: LONG QT SYNDROME 1/2, DIGENIC (disorder)
LONG QT SYNDROME 1/2, DIGENIC (disorder) 		0.700 0
dbSNP: rs121912515
rs121912515 		0.925 0.120 7 150974720 missense variant G/A;C;T snv
CUI: C3276240
Disease: LONG QT SYNDROME 2/3, DIGENIC
LONG QT SYNDROME 2/3, DIGENIC 		0.700 0
dbSNP: rs12720441
rs12720441 		1.000 0.080 7 150950216 missense variant G/A;C snv 4.0E-06; 4.0E-06
CUI: C3888153
Disease: LONG QT SYNDROME 2, ACQUIRED, SUSCEPTIBILITY TO
LONG QT SYNDROME 2, ACQUIRED, SUSCEPTIBILITY TO 		0.700 0
dbSNP: rs138498207
rs138498207 		1.000 0.120 7 150950195 missense variant G/A snv 7.6E-05 2.6E-04
CUI: C3150943
Disease: Long Qt Syndrome 2
Long Qt Syndrome 2 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554423863
rs1554423863 		1.000 0.120 7 150947005 stop gained G/A snv
CUI: C3150943
Disease: Long Qt Syndrome 2
Long Qt Syndrome 2 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554424079
rs1554424079 		1.000 0.120 7 150947381 frameshift variant -/GC delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554424083
rs1554424083 		1.000 0.120 7 150947383 frameshift variant -/ACCCG delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554424099
rs1554424099 		1.000 0.120 7 150947389 stop gained -/GGGCTGGAGAGGGGGATGTTGAGGAGGCTGGGGGTGGGGGCGGGGCATCGAGGGAGCTCCTGGTACTGGCGGCCCCGACTGTCCCCCCAGAAGCTGAAAATGTTGGACACTCCTGAGAAGGCGCCTGCAGCCAGAGAGCAGAGCTGGGTGAGCGGGGTAGACGCACCACCGCTGCCACGCCCGGTCCTCCCTCGCCCGCCCGTCGCCCGGGATACCTGACAGGGGGTTGCAAGTGTCGCTGCTCTTCTCGCAGTCCTCCATCAGGGGCTCCCCAC delins
CUI: C3150943
Disease: Long Qt Syndrome 2
Long Qt Syndrome 2 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554424138
rs1554424138 		1.000 0.120 7 150947426 frameshift variant G/- delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554424671
rs1554424671 		1.000 0.120 7 150948478 frameshift variant -/T delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554424772
rs1554424772 		1.000 7 150948855 splice donor variant C/T snv
CUI: C3277700
Disease: LONG QT SYNDROME 1/2, DIGENIC (disorder)
LONG QT SYNDROME 1/2, DIGENIC (disorder) 		0.700 0