Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1554425284
rs1554425284 		1.000 0.120 7 150950347 frameshift variant -/A delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554426219
rs1554426219 		1.000 0.120 7 150952646 frameshift variant -/A delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554431441
rs1554431441 		1.000 0.120 7 150977847 frameshift variant -/A delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554424083
rs1554424083 		1.000 0.120 7 150947383 frameshift variant -/ACCCG delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs863224478
rs863224478 		1.000 0.120 7 150958473 splice acceptor variant -/AGCTTCAGGCGGAAGGTCTTGGCGCGGCC delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs794728476
rs794728476 		7 150974765 inframe insertion -/ATCTGCGCG delins
CUI: C0003811
Disease: Cardiac Arrhythmia
Cardiac Arrhythmia 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs730880374
rs730880374 		1.000 0.120 7 150958132 frameshift variant -/C delins
CUI: C3150943
Disease: Long Qt Syndrome 2
Long Qt Syndrome 2 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs794728458
rs794728458 		1.000 0.120 7 150947785 frameshift variant -/C delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs794728434
rs794728434 		7 150952777 frameshift variant -/CAGG delins
CUI: C0003811
Disease: Cardiac Arrhythmia
Cardiac Arrhythmia 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs794728489
rs794728489 		7 150959670 frameshift variant -/CCAC ins
CUI: C0003811
Disease: Cardiac Arrhythmia
Cardiac Arrhythmia 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs794728467
rs794728467 		7 150947380 frameshift variant -/CCGCC;CGCC delins
CUI: C0003811
Disease: Cardiac Arrhythmia
Cardiac Arrhythmia 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs1131692183
rs1131692183 		1.000 0.120 7 150948456 frameshift variant -/CCTGC delins
CUI: C3150943
Disease: Long Qt Syndrome 2
Long Qt Syndrome 2 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs794728464
rs794728464 		7 150947512 splice region variant -/CTGC delins
CUI: C0003811
Disease: Cardiac Arrhythmia
Cardiac Arrhythmia 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs786204101
rs786204101 		1.000 0.120 7 150947670 frameshift variant -/G delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs794728465
rs794728465 		7 150947400 frameshift variant -/G delins
CUI: C0003811
Disease: Cardiac Arrhythmia
Cardiac Arrhythmia 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs869025447
rs869025447 		1.000 0.120 7 150958200 frameshift variant -/G delins
CUI: C3150943
Disease: Long Qt Syndrome 2
Long Qt Syndrome 2 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs869025448
rs869025448 		1.000 0.120 7 150952579 frameshift variant -/G delins
CUI: C3150943
Disease: Long Qt Syndrome 2
Long Qt Syndrome 2 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554424079
rs1554424079 		1.000 0.120 7 150947381 frameshift variant -/GC delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs794728449
rs794728449 		1.000 0.120 7 150947842 frameshift variant -/GCCCC delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs794728425
rs794728425 		1.000 0.120 7 150958220 frameshift variant -/GGCGATGGGAGCTGGCCGGG delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs794728425
rs794728425 		1.000 0.120 7 150958220 frameshift variant -/GGCGATGGGAGCTGGCCGGG delins
CUI: C0003811
Disease: Cardiac Arrhythmia
Cardiac Arrhythmia 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs1554424099
rs1554424099 		1.000 0.120 7 150947389 stop gained -/GGGCTGGAGAGGGGGATGTTGAGGAGGCTGGGGGTGGGGGCGGGGCATCGAGGGAGCTCCTGGTACTGGCGGCCCCGACTGTCCCCCCAGAAGCTGAAAATGTTGGACACTCCTGAGAAGGCGCCTGCAGCCAGAGAGCAGAGCTGGGTGAGCGGGGTAGACGCACCACCGCTGCCACGCCCGGTCCTCCCTCGCCCGCCCGTCGCCCGGGATACCTGACAGGGGGTTGCAAGTGTCGCTGCTCTTCTCGCAGTCCTCCATCAGGGGCTCCCCAC delins
CUI: C3150943
Disease: Long Qt Syndrome 2
Long Qt Syndrome 2 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs767910122
rs767910122 		0.724 0.280 7 150948446 frameshift variant -/GTCCG ins 4.4E-05
CUI: C0039070
Disease: Syncope
Syncope 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.020 1.000 2 2011 2017
dbSNP: rs767910122
rs767910122 		0.724 0.280 7 150948446 frameshift variant -/GTCCG ins 4.4E-05
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.020 1.000 2 2008 2010
dbSNP: rs767910122
rs767910122 		0.724 0.280 7 150948446 frameshift variant -/GTCCG ins 4.4E-05
CUI: C0344432
Disease: Ventricular tachycardia, polymorphic
Ventricular tachycardia, polymorphic 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.020 1.000 2 2016 2017