PYGL, glycogen phosphorylase L, 5836

N. diseases: 32; N. variants: 22
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs7142143
rs7142143 		1.000 0.120 14 50936813 intron variant T/C snv 2.8E-02
CUI: C1961102
Disease: Precursor Cell Lymphoblastic Leukemia Lymphoma
Precursor Cell Lymphoblastic Leukemia Lymphoma 		Neoplasms; Immune System Diseases; Hemic and Lymphatic Diseases 0.800 1.000 1 2012 2012
dbSNP: rs113993982
rs113993982 		1.000 0.080 14 50912155 splice donor variant C/G;T snv 4.0E-05
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 1.000 3 1998 2012
dbSNP: rs113993981
rs113993981 		1.000 0.080 14 50913028 splice donor variant C/A;G;T snv 4.0E-06; 8.0E-06; 2.4E-05
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 1.000 1 1998 1998
dbSNP: rs149096315
rs149096315 		1.000 0.080 14 50912195 stop gained G/A snv 6.0E-05 9.8E-05
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 1.000 1 2014 2014
dbSNP: rs17123039
rs17123039 		14 50865617 non coding transcript exon variant T/G snv 0.35
CUI: C0337443
Disease: Sodium measurement
Sodium measurement 		0.700 1.000 1 2019 2019
dbSNP: rs35026927
rs35026927 		1.000 0.080 14 50911799 missense variant C/A;G snv 4.0E-06; 3.7E-03
CUI: C2985280
Disease: Blood Protein Measurement
Blood Protein Measurement 		0.700 1.000 1 2018 2018
dbSNP: rs756205397
rs756205397 		1.000 0.080 14 50905469 stop gained G/A;C snv 6.4E-05
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 1.000 1 2013 2013
dbSNP: rs113993973
rs113993973 		1.000 0.080 14 50937801 stop gained G/A snv 1.6E-05 4.9E-05
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs113993974
rs113993974 		1.000 0.080 14 50924101 splice acceptor variant C/G snv
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs113993976
rs113993976 		1.000 0.080 14 50916718 missense variant T/C snv
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs113993977
rs113993977 		1.000 0.080 14 50915933 missense variant G/C snv
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs113993978
rs113993978 		1.000 0.080 14 50915869 stop gained G/A snv 8.0E-06 7.0E-06
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs113993979
rs113993979 		1.000 0.080 14 50915373 missense variant C/T snv 3.6E-05 2.8E-05
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs113993980
rs113993980 		1.000 0.080 14 50914748 missense variant G/A snv 2.4E-05 2.1E-05
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs113993983
rs113993983 		1.000 0.080 14 50911804 missense variant T/A snv
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs113993984
rs113993984 		1.000 0.080 14 50910055 missense variant C/T snv 4.0E-05 2.8E-05
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs113993985
rs113993985 		1.000 0.080 14 50910049 missense variant A/T snv
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs113993986
rs113993986 		1.000 0.080 14 50910048 missense variant G/A;C snv 4.0E-06; 4.0E-06
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs113993988
rs113993988 		1.000 0.080 14 50905475 missense variant A/G snv 3.2E-05 2.8E-05
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs1555328280
rs1555328280 		1.000 0.080 14 50937774 frameshift variant TGATCATGGT/- delins
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs28564871
rs28564871 		1.000 0.080 14 50901892 missense variant A/G;T snv 0.24; 4.2E-06
CUI: C0006142
Disease: Malignant neoplasm of breast
Malignant neoplasm of breast 		Neoplasms; Skin and Connective Tissue Diseases 0.700 0
dbSNP: rs35026927
rs35026927 		1.000 0.080 14 50911799 missense variant C/A;G snv 4.0E-06; 3.7E-03
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs786204785
rs786204785 		1.000 0.080 14 50944359 frameshift variant -/ATCTGCCGCCGCTTCTCCTG delins 4.0E-06 7.0E-06
CUI: C0017925
Disease: Glycogen Storage Disease Type VI
Glycogen Storage Disease Type VI 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0