Disease: Saethre-Chotzen Syndrome ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1554441989
rs1554441989 		1.000 0.080 7 19116904 inframe insertion -/GGGCAGCGTGGGGATGATCTT delins
CUI: C0175699
Disease: Saethre-Chotzen Syndrome
Saethre-Chotzen Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.700 0