VHL, von Hippel-Lindau tumor suppressor, 7428

N. diseases: 47; N. variants: 204
Source: CURATED ×
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1060503552
rs1060503552
0.925 0.160 3 10142073 frameshift variant TT/- del
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1064793878
rs1064793878
1.000 0.120 3 10149874 missense variant T/C snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1064796408
rs1064796408
0.925 0.160 3 10142023 frameshift variant GGCCCGTGCTGCGC/- delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1131690964
rs1131690964
1.000 0.120 3 10142124 frameshift variant G/- delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs143985153
rs143985153
1.000 0.120 3 10142116 missense variant A/C;G;T snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553619402
rs1553619402
1.000 0.120 3 10142035 frameshift variant -/G delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553619415
rs1553619415
1.000 0.120 3 10142052 frameshift variant -/G delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553619923
rs1553619923
1.000 0.120 3 10146488 coding sequence variant -/TAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553619952
rs1553619952
1.000 0.120 3 10146550 frameshift variant A/- del
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553619976
rs1553619976
0.925 0.160 3 10146593 frameshift variant -/A delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553620331
rs1553620331
1.000 0.120 3 10149854 frameshift variant ACTGGACATCGT/TC delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553620362
rs1553620362
1.000 0.120 3 10149907 frameshift variant GA/- delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559425925
rs1559425925
1.000 0.120 3 10142079 frameshift variant A/- delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559425951
rs1559425951
1.000 0.120 3 10142085 frameshift variant GTCCGCGCGTCGTGCTGCCCGTA/- delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559426095
rs1559426095
1.000 0.120 3 10142137 frameshift variant TACC/- delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559426115
rs1559426115
1.000 0.120 3 10142141 stop gained C/G snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559426145
rs1559426145
1.000 0.120 3 10142150 frameshift variant -/CC delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559428051
rs1559428051
1.000 0.120 3 10146517 frameshift variant -/C delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559428056
rs1559428056
1.000 0.120 3 10146523 stop gained G/A snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559428107
rs1559428107
1.000 0.120 3 10146552 frameshift variant G/- delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559428128
rs1559428128
1.000 0.120 3 10146565 frameshift variant -/CC delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559428134
rs1559428134
1.000 0.120 3 10146568 frameshift variant A/- delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559428164
rs1559428164
1.000 0.120 3 10146585 frameshift variant C/- delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559428180
rs1559428180
1.000 0.120 3 10146592 protein altering variant TCAATGTTG/ACAATTATTTGTGCCATCTCTCAA delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559428217
rs1559428217
1.000 0.120 3 10146605 frameshift variant CAGCCTA/- delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0