VHL, von Hippel-Lindau tumor suppressor, 7428

N. diseases: 47; N. variants: 204
Disease: Von Hippel-Lindau Syndrome ×
Source: CURATED ×
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs104893824
rs104893824 		0.776 0.320 3 10142181 missense variant T/A;C snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.810 1.000 31 1993 2017
dbSNP: rs104893825
rs104893825 		1.000 0.120 3 10149819 missense variant G/T snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.800 1.000 24 1993 2017
dbSNP: rs104893826
rs104893826 		0.882 0.200 3 10142038 missense variant G/A;C snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 1.000 8 1998 2014
dbSNP: rs104893829
rs104893829 		0.882 0.240 3 10142088 missense variant C/T snv 2.0E-04 3.8E-04
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.810 1.000 24 1993 2017
dbSNP: rs104893830
rs104893830 		0.925 0.160 3 10146561 missense variant G/C;T snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.800 1.000 29 1993 2017
dbSNP: rs1060503552
rs1060503552 		0.925 0.160 3 10142073 frameshift variant TT/- del
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1064793878
rs1064793878 		1.000 0.120 3 10149874 missense variant T/C snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1064794272
rs1064794272 		0.807 0.240 3 10146566 missense variant C/A snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.720 1.000 17 1993 2011
dbSNP: rs1064796408
rs1064796408 		0.925 0.160 3 10142023 frameshift variant GGCCCGTGCTGCGC/- delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1131690964
rs1131690964 		1.000 0.120 3 10142124 frameshift variant G/- delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs119103277
rs119103277 		0.925 0.160 3 10142110 stop gained G/A;C snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.810 0.875 7 2004 2017
dbSNP: rs121913346
rs121913346 		0.925 0.240 3 10149796 missense variant T/A;C snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.800 1.000 28 1993 2017
dbSNP: rs1347416980
rs1347416980 		1.000 0.120 3 10146568 missense variant A/C;G snv 4.0E-06
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 1.000 5 1999 2009
dbSNP: rs1352275281
rs1352275281 		1.000 0.120 3 10149815 missense variant G/C;T snv 8.0E-06
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.800 1.000 24 1993 2017
dbSNP: rs143985153
rs143985153 		1.000 0.120 3 10142116 missense variant A/C;G;T snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553619402
rs1553619402 		1.000 0.120 3 10142035 frameshift variant -/G delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553619415
rs1553619415 		1.000 0.120 3 10142052 frameshift variant -/G delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553619431
rs1553619431 		0.925 0.160 3 10142109 missense variant T/A;C snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.800 1.000 43 1993 2017
dbSNP: rs1553619440
rs1553619440 		1.000 0.120 3 10142125 missense variant G/A;T snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.800 1.000 32 1993 2017
dbSNP: rs1553619461
rs1553619461 		1.000 0.120 3 10142160 missense variant A/C snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.800 1.000 24 1993 2017
dbSNP: rs1553619923
rs1553619923 		1.000 0.120 3 10146488 coding sequence variant -/TAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA delins
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553619948
rs1553619948 		0.882 0.200 3 10146528 missense variant T/C snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.800 1.000 32 1993 2017
dbSNP: rs1553619952
rs1553619952 		1.000 0.120 3 10146550 frameshift variant A/- del
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553619956
rs1553619956 		1.000 0.120 3 10146555 missense variant C/T snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 1.000 17 1993 2006
dbSNP: rs1553619963
rs1553619963 		1.000 0.120 3 10146565 missense variant A/G snv
CUI: C0019562
Disease: Von Hippel-Lindau Syndrome
Von Hippel-Lindau Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Cardiovascular Diseases 0.700 1.000 3 2000 2009