TJP2, tight junction protein 2, 9414

N. diseases: 37; N. variants: 16
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs121918299
rs121918299 		1.000 0.080 9 69216367 missense variant T/C snv 5.2E-04
CUI: C1843139
Disease: Hypercholanemia, Familial
Hypercholanemia, Familial 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.800 1.000 1 2003 2003
dbSNP: rs11145465
rs11145465 		1.000 9 69151677 missense variant C/A snv 0.19
CUI: C0034951
Disease: Refractive Errors
Refractive Errors 		Eye Diseases 0.700 1.000 1 2013 2013
dbSNP: rs11145465
rs11145465 		1.000 9 69151677 missense variant C/A snv 0.19
CUI: C4025843
Disease: Abnormality of refraction
Abnormality of refraction 		0.700 1.000 1 2013 2013
dbSNP: rs11145488
rs11145488 		1.000 0.040 9 69156023 intron variant G/A snv 0.19
CUI: C0027092
Disease: Myopia
Myopia 		Eye Diseases 0.700 1.000 1 2016 2016
dbSNP: rs1554669525
rs1554669525 		1.000 0.120 9 69254206 splice region variant TTCCAGACCCCCTGAGCCACAGAAAGCTCCTTCCAGACCTTATCAGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAGGAGTACCGCCAGCAGCTGTCAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGATACCGGGACACAGAATTATAG/- delins
CUI: C2931067
Disease: Cholestasis, progressive familial intrahepatic 4
Cholestasis, progressive familial intrahepatic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Nutritional and Metabolic Diseases 0.700 1.000 1 2014 2014
dbSNP: rs1057518679
rs1057518679 		1.000 0.120 9 69227794 frameshift variant T/- delins
CUI: C2931067
Disease: Cholestasis, progressive familial intrahepatic 4
Cholestasis, progressive familial intrahepatic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs1060499649
rs1060499649 		1.000 0.120 9 69226175 missense variant G/A snv 8.0E-06
CUI: C2931067
Disease: Cholestasis, progressive familial intrahepatic 4
Cholestasis, progressive familial intrahepatic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs1278244243
rs1278244243 		0.925 0.120 9 69225409 splice donor variant T/C snv 1.2E-05
CUI: C1843139
Disease: Hypercholanemia, Familial
Hypercholanemia, Familial 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs1278244243
rs1278244243 		0.925 0.120 9 69225409 splice donor variant T/C snv 1.2E-05
CUI: C2931067
Disease: Cholestasis, progressive familial intrahepatic 4
Cholestasis, progressive familial intrahepatic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs1554660803
rs1554660803 		1.000 0.120 9 69221354 frameshift variant CG/- delins
CUI: C2931067
Disease: Cholestasis, progressive familial intrahepatic 4
Cholestasis, progressive familial intrahepatic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs587777518
rs587777518 		1.000 0.120 9 69221310 frameshift variant GCCT/- del
CUI: C2931067
Disease: Cholestasis, progressive familial intrahepatic 4
Cholestasis, progressive familial intrahepatic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs587777519
rs587777519 		1.000 0.120 9 69221426 frameshift variant C/- delins
CUI: C2931067
Disease: Cholestasis, progressive familial intrahepatic 4
Cholestasis, progressive familial intrahepatic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs587777520
rs587777520 		1.000 0.120 9 69228022 frameshift variant C/- del
CUI: C2931067
Disease: Cholestasis, progressive familial intrahepatic 4
Cholestasis, progressive familial intrahepatic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs587777521
rs587777521 		1.000 0.120 9 69236947 splice acceptor variant A/G snv
CUI: C2931067
Disease: Cholestasis, progressive familial intrahepatic 4
Cholestasis, progressive familial intrahepatic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs776869985
rs776869985 		1.000 0.120 9 69240013 frameshift variant T/-;TT delins 4.0E-06 7.0E-06
CUI: C2931067
Disease: Cholestasis, progressive familial intrahepatic 4
Cholestasis, progressive familial intrahepatic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs864321695
rs864321695 		1.000 0.120 9 69248011 splice acceptor variant G/T snv
CUI: C2931067
Disease: Cholestasis, progressive familial intrahepatic 4
Cholestasis, progressive familial intrahepatic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs864321697
rs864321697 		1.000 0.120 9 69221358 frameshift variant G/- delins
CUI: C2931067
Disease: Cholestasis, progressive familial intrahepatic 4
Cholestasis, progressive familial intrahepatic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Nutritional and Metabolic Diseases 0.700 0
dbSNP: rs886041948
rs886041948 		1.000 0.120 9 69221112 frameshift variant -/CCTCA delins
CUI: C2931067
Disease: Cholestasis, progressive familial intrahepatic 4
Cholestasis, progressive familial intrahepatic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Nutritional and Metabolic Diseases 0.700 0