CDH1, cadherin 1, 999

N. diseases: 508; N. variants: 187
Disease: Neoplastic Syndromes, Hereditary ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs786202290
rs786202290 		16 68819425 missense variant G/A snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2001 2001
dbSNP: rs786202712
rs786202712 		16 68819417 missense variant C/G;T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs876661091
rs876661091 		16 68812183 missense variant G/A snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1555516200
rs1555516200 		1.000 0.080 16 68815760 splice donor variant -/T;TT delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 4 2008 2014
dbSNP: rs587780113
rs587780113 		1.000 0.080 16 68815760 splice donor variant G/A;C;T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 4 2002 2016
dbSNP: rs786202817
rs786202817 		16 68812265 splice donor variant T/C snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 3 1999 2008
dbSNP: rs876660771
rs876660771 		1.000 0.080 16 68812264 splice donor variant G/A snv 4.0E-06 7.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 2 1999 2017
dbSNP: rs1131690808
rs1131690808 		1.000 0.080 16 68808568 splice donor variant G/A;T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1555515296
rs1555515296 		16 68808848 splice donor variant GT/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1555516191
rs1555516191 		16 68815744 splice donor variant AACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1567508847
rs1567508847 		16 68815574 splice donor variant A/- del
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs786203089
rs786203089 		1.000 0.080 16 68819425 splice donor variant TAAGGG/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs876659446
rs876659446 		1.000 0.080 16 68812263 splice donor variant G/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs878854697
rs878854697 		1.000 0.080 16 68810342 splice donor variant G/A;T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs886041161
rs886041161 		1.000 0.080 16 68819426 splice donor variant G/A;C snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs587783048
rs587783048 		1.000 0.080 16 68829753 frameshift variant C/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 10 2001 2016
dbSNP: rs786203752
rs786203752 		1.000 0.080 16 68829785 frameshift variant T/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 3 2007 2015
dbSNP: rs1555514492
rs1555514492 		1.000 0.080 16 68801885 frameshift variant C/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 2 2004 2009
dbSNP: rs587781290
rs587781290 		1.000 0.080 16 68808552 frameshift variant -/A delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 2 2007 2015
dbSNP: rs1131690809
rs1131690809 		16 68808764 frameshift variant T/- del
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2015 2015
dbSNP: rs1131690822
rs1131690822 		16 68833339 frameshift variant -/G delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2010 2010
dbSNP: rs1555515731
rs1555515731 		0.882 0.160 16 68812189 frameshift variant T/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2005 2005
dbSNP: rs1555518221
rs1555518221 		1.000 0.080 16 68833320 frameshift variant -/C delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2010 2010
dbSNP: rs876658261
rs876658261 		1.000 0.080 16 68815681 frameshift variant CGAGGAC/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 1999 1999
dbSNP: rs876661118
rs876661118 		16 68822063 frameshift variant -/C delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2004 2004