Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
C | 0.800 | GeneticVariation | GWASCAT | Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. | 23273568 | 2013 | ||||||
|
|
|
C | 0.800 | GeneticVariation | GWASDB | Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. | 23273568 | 2013 | ||||||
|
|
|
C | 0.800 | GeneticVariation | GWASDB | Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. | 23273568 | 2013 | ||||||
|
|
|
C | 0.800 | GeneticVariation | GWASCAT | Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. | 23273568 | 2013 | ||||||
|
|
|
0.730 | GeneticVariation | BEFREE | Our present study showed evidence that CDKN1B Val 109 Gly variant is not related to PCa risk. | 31257659 | 2019 | |||||||
|
|
|
T | 0.730 | GeneticVariation | GWASCAT | Association analyses of more than 140,000 men identify 63 new prostate cancer susceptibility loci. | 29892016 | 2018 | ||||||
|
|
|
0.730 | GeneticVariation | BEFREE | Further large-scale studies are needed to clarify the role of CDKN1B V109G polymorphism on prostate cancer risk. | 18645269 | 2008 | |||||||
|
|
|
0.730 | GeneticVariation | BEFREE | In addition, a case-control study has shown that the 326T/G (V109G) polymorphism in CDKN1B is associated with advanced prostate cancer. | 15026335 | 2004 | |||||||
|
|
|
0.700 | GeneticVariation | GWASCAT | Leveraging Polygenic Functional Enrichment to Improve GWAS Power. | 30595370 | 2019 | |||||||
|
|
|
0.700 | GeneticVariation | GWASCAT | Leveraging Polygenic Functional Enrichment to Improve GWAS Power. | 30595370 | 2019 | |||||||
|
|
|
0.700 | GeneticVariation | GWASCAT | Leveraging Polygenic Functional Enrichment to Improve GWAS Power. | 30595370 | 2019 | |||||||
|
|
|
A | 0.700 | GeneticVariation | GWASCAT | Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals. | 30038396 | 2018 | ||||||
|
|
|
A | 0.700 | GeneticVariation | GWASCAT | Interethnic analyses of blood pressure loci in populations of East Asian and European descent. | 30487518 | 2018 | ||||||
|
|
|
0.700 | GeneticVariation | GWASDB | Large-scale gene-centric meta-analysis across 32 studies identifies multiple lipid loci. | 23063622 | 2012 | |||||||
|
|
|
0.700 | GeneticVariation | GWASDB | Large-scale gene-centric meta-analysis across 32 studies identifies multiple lipid loci. | 23063622 | 2012 | |||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
GC | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
GCAGGCGGAGCACCCCAAGC | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR |