| Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
A | 0.700 | CausalMutation | CLINVAR | Haploinsufficiency of ALX4 as a potential cause of parietal foramina in the 11p11.2 contiguous gene-deletion syndrome. | 11017806 | 2000 | ||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | The ALX4 homeobox gene is mutated in patients with ossification defects of the skull (foramina parietalia permagna, OMIM 168500). | 11106354 | 2000 | ||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | The ALX4 homeobox gene is mutated in patients with ossification defects of the skull (foramina parietalia permagna, OMIM 168500). | 11106354 | 2000 | ||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
AGTTGCCATCTCTGTTGAGATCTTAG | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR |