RECQL4, RecQ like helicase 4, 9401
N. diseases: 249; N. variants: 73
Source: ALL
Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
T | 0.700 | CausalMutation | CLINVAR | Bronchiectasis in two pediatric patients with Rothmund-Thomson syndrome. | 17250521 | 2007 | ||||||
|
|
|
A | 0.700 | GeneticVariation | CLINVAR | Association between osteosarcoma and deleterious mutations in the RECQL4 gene in Rothmund-Thomson syndrome. | 12734318 | 2003 | ||||||
|
|
|
A | 0.700 | GeneticVariation | CLINVAR | Rothmund-Thomson syndrome due to RECQ4 helicase mutations: report and clinical and molecular comparisons with Bloom syndrome and Werner syndrome. | 10678659 | 2000 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
GTGCTGCGCTCCTCATCCTGC | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
C | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | CausalMutation | CLINVAR |