Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
---|---|---|---|---|---|---|---|---|---|---|
|
A | 0.700 | CausalMutation | CLINVAR | Inherited mutations in 17 breast cancer susceptibility genes among a large triple-negative breast cancer cohort unselected for family history of breast cancer. | 25452441 | 2015 |
|||
|
A | 0.700 | CausalMutation | CLINVAR | Contribution of Germline Mutations in the RAD51B, RAD51C, and RAD51D Genes to Ovarian Cancer in the Population. | 26261251 | 2015 |
|||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | GeneticVariation | CLINVAR | ||||||
|
T | 0.700 | GeneticVariation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | Inherited Mutations in Women With Ovarian Carcinoma. | 26720728 | 2016 |
|||
|
A | 0.700 | CausalMutation | CLINVAR | Germline mutations in RAD51D confer susceptibility to ovarian cancer. | 21822267 | 2011 |
|||
|
A | 0.700 | GeneticVariation | CLINVAR | Detection of Germline Mutations in Patients with Epithelial Ovarian Cancer Using Multi-gene Panels: Beyond BRCA1/2. | 29020732 | 2018 |
|||
|
A | 0.700 | GeneticVariation | CLINVAR | Individualized iterative phenotyping for genome-wide analysis of loss-of-function mutations. | 26046366 | 2015 |
|||
|
TG | 0.700 | GeneticVariation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | GeneticVariation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
GA | 0.700 | GeneticVariation | CLINVAR | RAD51 protein ATP cap regulates nucleoprotein filament stability. | 22275364 | 2012 |
|||
|
GA | 0.700 | GeneticVariation | CLINVAR | Contribution of Germline Mutations in the RAD51B, RAD51C, and RAD51D Genes to Ovarian Cancer in the Population. | 26261251 | 2015 |
|||
|
GA | 0.700 | CausalMutation | CLINVAR | ||||||
|
GA | 0.700 | GeneticVariation | CLINVAR | Inherited mutations in 17 breast cancer susceptibility genes among a large triple-negative breast cancer cohort unselected for family history of breast cancer. | 25452441 | 2015 |
|||
|
C | 0.700 | GeneticVariation | CLINVAR | Gene panel sequencing in familial breast/ovarian cancer patients identifies multiple novel mutations also in genes others than BRCA1/2. | 27616075 | 2017 |
|||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | GeneticVariation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | GeneticVariation | CLINVAR | ||||||
|
T | 0.700 | GeneticVariation | CLINVAR | Contribution of Germline Mutations in the RAD51B, RAD51C, and RAD51D Genes to Ovarian Cancer in the Population. | 26261251 | 2015 |
|||
|
T | 0.700 | GeneticVariation | CLINVAR | Inherited Mutations in Women With Ovarian Carcinoma. | 26720728 | 2016 |
|||
|
GTCTTCAGTTCCTCGTAGAGA | 0.700 | CausalMutation | CLINVAR |