Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
---|---|---|---|---|---|---|---|---|---|---|
|
0.800 | GeneticVariation | UNIPROT | |||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
0.700 | GeneticVariation | UNIPROT | |||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
CTGCTGCTGCTGCTGCTGCTGCTG | 0.700 | SusceptibilityMutation | CLINVAR | ||||||
|
G | 0.700 | SusceptibilityMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | SusceptibilityMutation | CLINVAR | ||||||
|
0.700 | GeneticVariation | UNIPROT | |||||||
|
T | 0.700 | SusceptibilityMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
0.700 | GeneticVariation | UNIPROT | |||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | SusceptibilityMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | SusceptibilityMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
0.010 | GeneticVariation | BEFREE | Ribonuclease protection assay analysis of ASA mRNA transcripts and an investigation into the activity and lysosomal localization of protein expressed by an ASA expression construct containing the N350S variant indicated that both the N350S and polyadenylation defects play a role in biochemically defining the ASA-PD phenotype. | 9668161 | 1998 |