Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs118203998
rs118203998
8 0.821 0.357 16 23603471 stop gained G/C,T snp 1.6E-05; 4.0E-06 0.700 19 2007 2017
dbSNP: rs137853007
rs137853007
5 0.846 0.179 22 28725254 missense variant G/A,T snp 5.2E-05 3.2E-05 0.700 16 2001 2017
dbSNP: rs515726117
rs515726117
2 1.000 0.071 16 23603658 frameshift variant AC/A in-del 4.0E-06 0.700 13 2006 2017
dbSNP: rs587776428
rs587776428
2 1.000 0.071 16 23603515 frameshift variant GAG/G in-del 0.700 13 2006 2017
dbSNP: rs121908698
rs121908698
4 1.000 0.071 22 28725242 splice donor variant C/A,T snp 4.0E-06; 1.3E-04 2.2E-04 0.700 12 2003 2017
dbSNP: rs587776426
rs587776426
2 1.000 0.071 16 23603563 frameshift variant G/GT in-del 0.700 11 2006 2017
dbSNP: rs515726123
rs515726123
3 1.000 0.071 16 23636037 frameshift variant TCT/T in-del 0.700 10 2010 2017
dbSNP: rs515726126
rs515726126
2 1.000 0.071 16 23635788 frameshift variant A/AA in-del 0.700 10 2012 2017
dbSNP: rs587780024
rs587780024
3 0.923 0.179 2 214730457 frameshift variant T/TCATACTTTTCTTCCTGTTCA in-del 6.4E-05 3.2E-05 0.700 10 2007 2017
dbSNP: rs180177083
rs180177083
3 0.923 0.179 16 23637865 stop gained G/A,T snp 8.0E-06; 4.0E-06 0.700 9 2011 2017
dbSNP: rs180177100
rs180177100
6 0.846 0.357 16 23635306 stop gained G/A snp 8.0E-06 0.700 9 2011 2017
dbSNP: rs587782401
rs587782401
5 0.846 0.179 22 28734401 splice donor variant A/G,T snp 4.0E-06; 6.8E-05 3.8E-04 0.700 9 2012 2018
dbSNP: rs180177110
rs180177110
2 1.000 0.071 16 23629897 stop gained G/A,T snp 2.4E-05 0.700 8 2007 2017
dbSNP: rs180177127
rs180177127
2 1.000 0.071 16 23622982 frameshift variant C/CA in-del 0.700 8 2007 2017
dbSNP: rs587780021
rs587780021
4 0.878 0.179 2 214745842 stop gained G/A snp 2.4E-05 3.2E-05 0.700 8 2012 2017
dbSNP: rs180177102
rs180177102
3 1.000 0.071 16 23634954 frameshift variant CA/C in-del 1.8E-04 9.6E-05 0.700 7 2007 2017
dbSNP: rs180177111
rs180177111
5 0.878 0.071 16 23629831 stop gained G/A snp 4.0E-06 0.700 7 2008 2017
dbSNP: rs180177112
rs180177112
2 1.000 0.071 16 23629768 stop gained C/A snp 4.0E-06 3.2E-05 0.700 7 2007 2017
dbSNP: rs587776527
rs587776527
3 1.000 0.071 16 23607958 stop gained G/A,C snp 2.0E-05 0.700 7 2009 2017
dbSNP: rs730881687
rs730881687
2 1.000 0.071 22 28710060 splice acceptor variant C/A,T snp 1.2E-05; 1.6E-05 0.700 7 2012 2017
dbSNP: rs773829275
rs773829275
1 1.000 0.071 16 23603526 missense variant G/A snp 4.0E-06 0.700 7 2007 2017
dbSNP: rs149364097
rs149364097
3 0.923 0.179 17 61801348 missense variant C/A,G,T snp 1.6E-05 3.2E-05 0.700 6 2005 2017
dbSNP: rs180177092
rs180177092
4 0.923 0.179 16 23635788 frameshift variant TAG/T in-del 0.700 6 2007 2017
dbSNP: rs180177135
rs180177135
4 0.878 0.250 16 23607891 frameshift variant GT/G in-del 0.700 6 2009 2017
dbSNP: rs41293463
rs41293463
8 0.801 0.179 17 43051071 missense variant A/C,T snp 1.2E-05 3.2E-05 0.700 6 1994 2008